| Title: | Miscellaneous Functions for Metabarcoding Analysis |
|---|---|
| Description: | Facilitate the description, transformation, exploration, and reproducibility of metabarcoding analyses. 'MiscMetabar' is mainly built on top of the 'phyloseq', 'dada2' and 'targets' 'R' packages. It helps to build reproducible and robust bioinformatics pipelines in 'R'. 'MiscMetabar' makes ecological analysis of alpha and beta-diversity easier, more reproducible and more powerful by integrating a large number of tools. Important features are described in Taudière A. (2023) <doi:10.21105/joss.06038>. |
| Authors: | Adrien Taudière [aut, cre, cph] (ORCID: <https://orcid.org/0000-0003-1088-1182>) |
| Maintainer: | Adrien Taudière <[email protected]> |
| License: | AGPL-3 |
| Version: | 0.16.8 |
| Built: | 2026-06-09 10:43:36 UTC |
| Source: | https://github.com/adrientaudiere/miscmetabar |
MiscMetabar packageFunctions to help analyze and visualize metabarcoding data. Mainly based on the phyloseq and dada2 packages.
phyloseq-class objectNote that as most bioinformatic pipeline discard singleton, accumulation curves from metabarcoding cannot be interpreted in the same way as with conventional biodiversity sampling techniques.
accu_plot( physeq, fact = NULL, add_nb_seq = TRUE, step = NULL, by.fact = FALSE, ci_col = NULL, col = NULL, lwd = 3, leg = TRUE, print_sam_names = FALSE, ci = 2, ... )accu_plot( physeq, fact = NULL, add_nb_seq = TRUE, step = NULL, by.fact = FALSE, ci_col = NULL, col = NULL, lwd = 3, leg = TRUE, print_sam_names = FALSE, ci = 2, ... )
physeq |
(required) a |
fact |
(required) Name of the factor in |
add_nb_seq |
(default: TRUE, logical) Either plot accumulation curves using sequences or using samples |
step |
(Integer) distance among points calculated to plot lines. A
low value give better plot but is more time consuming.
Only used if |
by.fact |
(default: FALSE, logical) First merge the OTU table by factor to plot only one line by factor |
ci_col |
Color vector for confidence interval.
Only use if |
col |
Color vector for lines. Only use if |
lwd |
(default: 3) thickness for lines. Only use if |
leg |
(default: TRUE, logical) Plot legend or not. Only use if |
print_sam_names |
(default: FALSE, logical) Print samples names or not?
Only use if |
ci |
(default: 2, integer) Confidence interval value used to multiply the standard error to plot confidence interval |
... |
Additional arguments passed on to |
A ggplot2 plot representing the richness
accumulation plot if add_nb_seq = TRUE, else, if add_nb_seq = FALSE
return a base plot.
Adrien Taudière
specaccum accu_samp_threshold()
data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- rarefy_pq(subset_samples_pq(GP, sample_sums(GP) > 3000), replace = TRUE) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, by.fact = TRUE, step = 10) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, step = 10) p + theme(legend.position = "none") p + xlim(c(0, 400))data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- rarefy_pq(subset_samples_pq(GP, sample_sums(GP) > 3000), replace = TRUE) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, by.fact = TRUE, step = 10) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, step = 10) p + theme(legend.position = "none") p + xlim(c(0, 400))
This function (i) rarefy (equalize) the number of samples per modality of a factor and (ii) rarefy the number of sequences per sample (depth). The seed is set to 1:nperm. Thus, with exacly the same parameter, including nperm values, results must be identical.
accu_plot_balanced_modality( physeq, fact, nperm = 99, step = 2000, by.fact = TRUE, progress_bar = TRUE, quantile_prob = 0.975, rarefy_by_sample_before_merging = TRUE, sample.size = 1000, verbose = FALSE, ... )accu_plot_balanced_modality( physeq, fact, nperm = 99, step = 2000, by.fact = TRUE, progress_bar = TRUE, quantile_prob = 0.975, rarefy_by_sample_before_merging = TRUE, sample.size = 1000, verbose = FALSE, ... )
physeq |
(required) a |
fact |
(required) The variable to rarefy. Must be present in
the |
nperm |
(int) The number of permutations to perform. |
step |
(int) distance among points calculated to plot lines. A low value give better plot but is more time consuming. |
by.fact |
(logical, default TRUE) First merge the OTU table by factor to plot only one line by factor |
progress_bar |
(logical, default TRUE) Do we print progress during the calculation? |
quantile_prob |
(float, |
rarefy_by_sample_before_merging |
(logical, default TRUE): rarefy_by_sample_before_merging = FALSE is buggy for the moment.Please only use rarefy_by_sample_before_merging = TRUE |
sample.size |
(int) A single integer value equal to the number of
reads being simulated, also known as the depth. See
|
verbose |
(logical). If TRUE, print additional information. |
... |
Other params for be passed on to |
A ggplot2 plot representing the richness accumulation plot
Adrien Taudière
accu_plot(), rarefy_sample_count_by_modality(), phyloseq::rarefy_even_depth()
data_fungi_woNA4Time <- subset_samples(data_fungi_mini, !is.na(Time)) data_fungi_woNA4Time@sam_data$Time <- paste0("time-", data_fungi_woNA4Time@sam_data$Time) accu_plot_balanced_modality(data_fungi_woNA4Time, "Time", nperm = 3) data_fungi_woNA4Height <- subset_samples(data_fungi_mini, !is.na(Height)) accu_plot_balanced_modality(data_fungi_woNA4Height, "Height", nperm = 3)data_fungi_woNA4Time <- subset_samples(data_fungi_mini, !is.na(Time)) data_fungi_woNA4Time@sam_data$Time <- paste0("time-", data_fungi_woNA4Time@sam_data$Time) accu_plot_balanced_modality(data_fungi_woNA4Time, "Time", nperm = 3) data_fungi_woNA4Height <- subset_samples(data_fungi_mini, !is.na(Height)) accu_plot_balanced_modality(data_fungi_woNA4Height, "Height", nperm = 3)
Note that as most bioinformatic pipeline discard singleton, accumulation curves from metabarcoding cannot be interpreted in the same way as with conventional biodiversity sampling techniques.
accu_samp_threshold(res_accuplot, threshold = 0.95)accu_samp_threshold(res_accuplot, threshold = 0.95)
res_accuplot |
the result of the function accu_plot() |
threshold |
the proportion of ASV to obtain in each samples |
a value for each sample of the number of sequences needed
to obtain threshold proportion of the ASV
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- rarefy_pq(subset_samples_pq(GP, sample_sums(GP) > 3000), replace = TRUE) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, by.fact = TRUE, step = 10) val_threshold <- accu_samp_threshold(p) summary(val_threshold) ##' Plot the number of sequences needed to accumulate 0.95% of ASV in 50%, 75% ##' and 100% of samples p + geom_vline(xintercept = quantile(val_threshold, probs = c(0.50, 0.75, 1)))data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- rarefy_pq(subset_samples_pq(GP, sample_sums(GP) > 3000), replace = TRUE) p <- accu_plot(GP, "SampleType", add_nb_seq = TRUE, by.fact = TRUE, step = 10) val_threshold <- accu_samp_threshold(p) summary(val_threshold) ##' Plot the number of sequences needed to accumulate 0.95% of ASV in 50%, 75% ##' and 100% of samples p + geom_vline(xintercept = quantile(val_threshold, probs = c(0.50, 0.75, 1)))
blast_pq() to the tax_table slot of a phyloseq objectBasically a wrapper of blast_pq() with option unique_per_seq = TRUE and
score_filter = FALSE.
Add the information to the taxtable
add_blast_info( physeq, fasta_for_db, silent = FALSE, suffix = "blast_info", ... )add_blast_info( physeq, fasta_for_db, silent = FALSE, suffix = "blast_info", ... )
physeq |
(required) a |
fasta_for_db |
path to a fasta file to make the blast database |
silent |
(logical) If true, no message are printing. |
suffix |
(character) The suffix to name the new columns. Set the suffix to "" in order to remove any suffix. |
... |
Additional arguments passed on to |
A new phyloseq-class object with more information in tax_table based on a
blast on a given database
Adrien Taudière
## Not run: add_blast_info(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)## Not run: add_blast_info(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)
refseq slot of a physeq object using taxa names and renames taxa
using prefix_taxa_names and number (default Taxa_1, Taxa_2 ...)Useful in targets bioinformatic pipeline.
add_dna_to_phyloseq(physeq, prefix_taxa_names = "Taxa_")add_dna_to_phyloseq(physeq, prefix_taxa_names = "Taxa_")
physeq |
(required) a |
prefix_taxa_names |
(default "Taxa_"): the prefix of taxa names (eg. "ASV_" or "OTU_") |
A new phyloseq-class object with refseq slot and new
taxa names
Adrien Taudière
pq_seq_names <- phyloseq::phyloseq( phyloseq::otu_table(data_fungi_mini), phyloseq::sample_data(data_fungi_mini), phyloseq::tax_table(data_fungi_mini) ) phyloseq::taxa_names(pq_seq_names) <- as.character(phyloseq::refseq(data_fungi_mini)) add_dna_to_phyloseq(pq_seq_names)pq_seq_names <- phyloseq::phyloseq( phyloseq::otu_table(data_fungi_mini), phyloseq::sample_data(data_fungi_mini), phyloseq::tax_table(data_fungi_mini) ) phyloseq::taxa_names(pq_seq_names) <- as.character(phyloseq::refseq(data_fungi_mini)) add_dna_to_phyloseq(pq_seq_names)
Please cite Nguyen et al. 2016 (doi:10.1016/j.funeco.2015.06.006)
add_funguild_info( physeq, taxLevels = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), db_url = "http://www.stbates.org/funguild_db_2.php" )add_funguild_info( physeq, taxLevels = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), db_url = "http://www.stbates.org/funguild_db_2.php" )
physeq |
(required) a |
taxLevels |
Name of the 7 columns in tax_table required by funguild |
db_url |
a length 1 character string giving the URL to retrieve the database from |
This function is mainly a wrapper of the work of others.
Please make a reference to FUNGuildR package and the associate
publication (doi:10.1016/j.funeco.2015.06.006) if you
use this function.
A new object of class physeq with Guild information added to
tax_table slot
Adrien Taudière
## Not run: # to avoid bug in CRAN when internet is not available if (requireNamespace("httr")) { d_fung_mini <- add_funguild_info(data_fungi_mini, taxLevels = c( "Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) ) sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE) } ## End(Not run)## Not run: # to avoid bug in CRAN when internet is not available if (requireNamespace("httr")) { d_fung_mini <- add_funguild_info(data_fungi_mini, taxLevels = c( "Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) ) sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE) } ## End(Not run)
Warning: The value nb_seq and nb_otu may be outdated if you transform your
phyloseq object, e.g. using the subset_taxa_pq() function
add_info_to_sam_data( physeq, df_info = NULL, add_nb_seq = TRUE, add_nb_otu = TRUE )add_info_to_sam_data( physeq, df_info = NULL, add_nb_seq = TRUE, add_nb_otu = TRUE )
physeq |
(required) a |
df_info |
: A dataframe with rownames matching for sample names of the phyloseq object |
add_nb_seq |
(Logical, default TRUE) Does we add a column nb_seq collecting the number of sequences per sample? |
add_nb_otu |
(Logical, default TRUE) Does we add a column nb_otu collecting the number of OTUs per sample? |
A phyloseq object with an updated sam_data slot
Adrien Taudière
data_fungi <- add_info_to_sam_data(data_fungi) boxplot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$Time) new_df <- data.frame( variable_1 = runif(n = nsamples(data_fungi), min = 1, max = 20), variable_2 = runif(n = nsamples(data_fungi), min = 1, max = 2) ) rownames(new_df) <- sample_names(data_fungi) data_fungi <- add_info_to_sam_data(data_fungi, new_df) plot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$variable_1)data_fungi <- add_info_to_sam_data(data_fungi) boxplot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$Time) new_df <- data.frame( variable_1 = runif(n = nsamples(data_fungi), min = 1, max = 20), variable_2 = runif(n = nsamples(data_fungi), min = 1, max = 2) ) rownames(new_df) <- sample_names(data_fungi) data_fungi <- add_info_to_sam_data(data_fungi, new_df) plot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$variable_1)
One of main use of this function is to add taxonomic assignment from a new database.
add_new_taxonomy_pq( physeq, ref_fasta, suffix = NULL, method = c("dada2", "sintax", "lca", "idtaxa", "blastn", "dada2_2steps"), trainingSet = NULL, min_bootstrap = NULL, ... )add_new_taxonomy_pq( physeq, ref_fasta, suffix = NULL, method = c("dada2", "sintax", "lca", "idtaxa", "blastn", "dada2_2steps"), trainingSet = NULL, min_bootstrap = NULL, ... )
physeq |
(required) a |
ref_fasta |
(required) A link to a database.
passed on to |
suffix |
(character) The suffix to name the new columns. If set to NULL (the default), the basename of the file reFasta is used with the name of the method. Set suffix to "" in order to remove any suffix. |
method |
(required, default "dada2") :
|
trainingSet |
see |
min_bootstrap |
(Float [0:1]) If null (default), the default value of each taxonomic assignation method is used (see after). Set to 0 to disable any bootstrap filtering. Minimum bootstrap value to inform taxonomy. For each bootstrap below the min_bootstrap value, the taxonomy information is set to NA. Correspond to parameters :
|
... |
Additional arguments passed on to the taxonomic assignation method. |
A new phyloseq-class object with a larger slot tax_table"
Adrien Taudière
dada2::assignTaxonomy(), assign_sintax(), assign_vsearch_lca(), assign_sintax(), assign_blastn(), assign_dada2()
## Not run: ref_fasta <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE ) add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "dada2") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "dada2_2steps") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "sintax") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "lca") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "idtaxa") # blastn doesn't work with fasta.gz format ref_fasta <- system.file("extdata", "100_sp_UNITE_sh_general_release_dynamic_sintax.fasta", package = "MiscMetabar", mustWork = TRUE ) dp <- add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "blastn", min_id = 80, min_cover = 50, min_bit_score = 20, min_e_value = 1e-20 ) dp_tophit <- add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "blastn", min_id = 80, min_cover = 50, min_bit_score = 20, min_e_value = 1e-20, method_algo = "top_hit" ) ## End(Not run)## Not run: ref_fasta <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE ) add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "dada2") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "dada2_2steps") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "sintax") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "lca") add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "idtaxa") # blastn doesn't work with fasta.gz format ref_fasta <- system.file("extdata", "100_sp_UNITE_sh_general_release_dynamic_sintax.fasta", package = "MiscMetabar", mustWork = TRUE ) dp <- add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "blastn", min_id = 80, min_cover = 50, min_bit_score = 20, min_e_value = 1e-20 ) dp_tophit <- add_new_taxonomy_pq(data_fungi_mini, ref_fasta, method = "blastn", min_id = 80, min_cover = 50, min_bit_score = 20, min_e_value = 1e-20, method_algo = "top_hit" ) ## End(Not run)
A wrapper for the vegan::adonis2() function in the case of physeq object.
adonis_pq( physeq, formula, dist_method = "bray", by = "terms", merge_sample_by = NULL, na_remove = FALSE, correction_for_sample_size = FALSE, rarefy_nb_seqs = FALSE, rngseed = FALSE, verbose = TRUE, ... )adonis_pq( physeq, formula, dist_method = "bray", by = "terms", merge_sample_by = NULL, na_remove = FALSE, correction_for_sample_size = FALSE, rarefy_nb_seqs = FALSE, rngseed = FALSE, verbose = TRUE, ... )
physeq |
(required) a |
formula |
(required) the right part of a formula for |
dist_method |
(default "bray") the distance used. See
|
by |
(character, default "terms") by = "terms" will assess significance
for each term (sequentially from first to last); if by = NULL ,
the p-value is computed for the entire model i.e. the overall significance
of all terms together is computed, setting by = "margin" will assess the
marginal effects of the terms (each marginal term analyzed in a model
with all other variables), by = "onedf" will analyze one-degree-of-freedom
contrasts sequentially. See |
merge_sample_by |
a vector to determine
which samples to merge using the |
na_remove |
(logical, default FALSE) If set to TRUE, remove samples with NA in the variables set in formula. |
correction_for_sample_size |
(logical, default FALSE) If set to TRUE,
the sample size (number of sequences by samples) is added to formula in
the form |
rarefy_nb_seqs |
(logical, default FALSE) Rarefy each sample
(before merging if merge_sample_by is set) using
|
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical, default TRUE) If TRUE, prompt some messages. |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::adonis2() if you
use this function.
The function returns an anova.cca result object with a
new column for partial R^2. See help of vegan::adonis2() for
more information.
Adrien Taudière
data(enterotype) adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE) adonis_pq(data_fungi_mini, "Time*Height", na_remove = TRUE, correction_for_sample_size = TRUE ) ## Not run: adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = NULL) adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = "onedf") adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = "margin") adonis_pq(enterotype, "SeqTech", dist_method = "jaccard") adonis_pq(enterotype, "SeqTech", dist_method = "robust.aitchison") ## End(Not run)data(enterotype) adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE) adonis_pq(data_fungi_mini, "Time*Height", na_remove = TRUE, correction_for_sample_size = TRUE ) ## Not run: adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = NULL) adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = "onedf") adonis_pq(enterotype, "SeqTech*Enterotype", na_remove = TRUE, by = "margin") adonis_pq(enterotype, "SeqTech", dist_method = "jaccard") adonis_pq(enterotype, "SeqTech", dist_method = "robust.aitchison") ## End(Not run)
Permanova are computed on a given number of rarefaction with different seed.number. This reduce the risk of a random drawing of a exceptional situation of an unique rarefaction.
adonis_rarperm_pq( physeq, formula, dist_method = "bray", merge_sample_by = NULL, na_remove = FALSE, rarefy_nb_seqs = FALSE, verbose = TRUE, nperm = 99, progress_bar = TRUE, quantile_prob = 0.975, sample.size = min(sample_sums(physeq)), ... )adonis_rarperm_pq( physeq, formula, dist_method = "bray", merge_sample_by = NULL, na_remove = FALSE, rarefy_nb_seqs = FALSE, verbose = TRUE, nperm = 99, progress_bar = TRUE, quantile_prob = 0.975, sample.size = min(sample_sums(physeq)), ... )
physeq |
(required) a |
formula |
(required) the right part of a formula for |
dist_method |
(default "bray") the distance used. See
|
merge_sample_by |
a vector to determine
which samples to merge using the |
na_remove |
(logical, default FALSE) If set to TRUE, remove samples with NA in the variables set in formula. |
rarefy_nb_seqs |
(logical, default FALSE) Rarefy each sample
(before merging if merge_sample_by is set) using
|
verbose |
(logical, default TRUE) If TRUE, prompt some messages. |
nperm |
(int, default = 99) The number of permutations to perform. |
progress_bar |
(logical, default TRUE) Do we print progress during the calculation. |
quantile_prob |
(float, |
sample.size |
(int) A single integer value equal to the number of
reads being simulated, also known as the depth. See
|
... |
Other params to be passed on to |
A list of three dataframe representing the mean, the minimum quantile
and the maximum quantile value for adonis results. See adonis_pq().
Adrien Taudière
if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples(data_fungi_mini, !is.na(Time) & !is.na(Height)) adonis_rarperm_pq(data_fungi_woNA, "Time*Height", na_remove = TRUE, nperm = 3) }if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples(data_fungi_mini, !is.na(Time) & !is.na(Height)) adonis_rarperm_pq(data_fungi_woNA, "Time*Height", na_remove = TRUE, nperm = 3) }
Run Aldex on a phyloseq object
aldex_pq(physeq, bifactor = NULL, modalities = NULL, gamma = 0.5, ...)aldex_pq(physeq, bifactor = NULL, modalities = NULL, gamma = 0.5, ...)
physeq |
(required) a |
bifactor |
(required) The name of a column present in the |
modalities |
(default NULL) A vector of modalities to keep in the analysis. If NULL, all modalities present in bifactor are kept. Note that only two modalities are allowed. |
gamma |
(default 0.5) The value of the Dirichlet Monte-Carlo sampling parameter. |
... |
Additional arguments passed on to |
It is a wrapper of the ALDEx2::aldex() function with default gamma=0.5.
The result of ALDEx2::aldex()
Adrien Taudière
if (requireNamespace("ALDEx2")) { res_aldex <- aldex_pq(data_fungi_mini, bifactor = "Height", modalities = c("Low", "High") ) ALDEx2::aldex.plot(res_aldex, type = "volcano") }if (requireNamespace("ALDEx2")) { res_aldex <- aldex_pq(data_fungi_mini, bifactor = "Height", modalities = c("Low", "High") ) ALDEx2::aldex.plot(res_aldex, type = "volcano") }
Code from https://tolstoy.newcastle.edu.au/R/e6/help/09/01/1121.html
all_object_size()all_object_size()
a list of size
all_object_size()all_object_size()
A wrapper for the ancombc2() function
ancombc_pq(physeq, fact, levels_fact = NULL, tax_level = "Class", ...)ancombc_pq(physeq, fact, levels_fact = NULL, tax_level = "Class", ...)
physeq |
(required) a |
fact |
(required) Name of the factor in |
levels_fact |
(default NULL) The order of the level in the factor. Used for reorder levels and select levels (filter out levels not present en levels_fact) |
tax_level |
(default NULL)
The taxonomic level passed on to |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to ancombc2() if you
use this function.
The result of ancombc2() function
Adrien Taudière
## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_height <- ancombc_pq( data_fungi_mini, fact = "Height", levels_fact = c("Low", "High"), verbose = TRUE ) ggplot( res_height$res, aes( y = reorder(taxon, lfc_HeightHigh), x = lfc_HeightHigh, color = diff_HeightHigh ) ) + geom_vline(xintercept = 0) + geom_segment(aes( xend = 0, y = reorder(taxon, lfc_HeightHigh), yend = reorder(taxon, lfc_HeightHigh) ), color = "darkgrey") + geom_point() res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "Family", verbose = TRUE ) } ## End(Not run)## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_height <- ancombc_pq( data_fungi_mini, fact = "Height", levels_fact = c("Low", "High"), verbose = TRUE ) ggplot( res_height$res, aes( y = reorder(taxon, lfc_HeightHigh), x = lfc_HeightHigh, color = diff_HeightHigh ) ) + geom_vline(xintercept = 0) + geom_segment(aes( xend = 0, y = reorder(taxon, lfc_HeightHigh), yend = reorder(taxon, lfc_HeightHigh) ), color = "darkgrey") + geom_point() res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "Family", verbose = TRUE ) } ## End(Not run)
The aim of this function is to provide a warnings if samples depth significantly
vary among the modalities of a factor present in the sam_data slot.
This function apply a Kruskal-Wallis rank sum test to the number of sequences
per samples in function of the factor fact.
are_modality_even_depth(physeq, fact, boxplot = FALSE)are_modality_even_depth(physeq, fact, boxplot = FALSE)
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
boxplot |
(logical) Do you want to plot boxplot? |
The result of a Kruskal-Wallis rank sum test
Adrien Taudière
are_modality_even_depth(data_fungi_mini, "Time")$p.value are_modality_even_depth(rarefy_pq(data_fungi_mini, replace = TRUE), "Time")$p.value are_modality_even_depth(data_fungi_mini, "Height", boxplot = TRUE)are_modality_even_depth(data_fungi_mini, "Time")$p.value are_modality_even_depth(rarefy_pq(data_fungi_mini, replace = TRUE), "Time")$p.value are_modality_even_depth(data_fungi_mini, "Height", boxplot = TRUE)
phyloseq-class object into a
phyloseq-class object with a binary otu_table.Useful to test if the results are not biased by sequences bias that appended during PCR or NGS pipeline.
as_binary_otu_table(physeq, min_number = 1)as_binary_otu_table(physeq, min_number = 1)
physeq |
(required) a |
min_number |
(int) the minimum number of sequences to put a 1 in the OTU table. |
A physeq object with only 0/1 in the OTU table
Adrien Taudière
data(enterotype) enterotype_bin <- as_binary_otu_table(enterotype)data(enterotype) enterotype_bin <- as_binary_otu_table(enterotype)
Use the blast software.
assign_blastn( physeq, ref_fasta = NULL, database = NULL, blastpath = NULL, behavior = c("return_matrix", "add_to_phyloseq"), method_algo = c("vote", "top-hit"), suffix = "_blastn", min_id = 95, min_bit_score = 50, min_cover = 95, min_e_value = 1e-30, nb_voting = NULL, column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), vote_algorithm = c("consensus", "rel_majority", "abs_majority", "unanimity"), strict = FALSE, nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = TRUE, simplify_taxo = TRUE, keep_blast_metrics = FALSE, ... )assign_blastn( physeq, ref_fasta = NULL, database = NULL, blastpath = NULL, behavior = c("return_matrix", "add_to_phyloseq"), method_algo = c("vote", "top-hit"), suffix = "_blastn", min_id = 95, min_bit_score = 50, min_cover = 95, min_e_value = 1e-30, nb_voting = NULL, column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), vote_algorithm = c("consensus", "rel_majority", "abs_majority", "unanimity"), strict = FALSE, nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = TRUE, simplify_taxo = TRUE, keep_blast_metrics = FALSE, ... )
physeq |
(required) a |
ref_fasta |
Either a DNAStringSet object or a path to a fasta
file to make the blast database. It must be in sintax format.
See |
database |
path to a blast database. Only used if ref_fasta is not set. |
blastpath |
path to blast program. |
behavior |
Either "return_matrix" (default), or "add_to_phyloseq":
|
method_algo |
(One of "vote" or "top-hit"). If top-hit, only the
better match is used to assign taxonomy. If vote, the algorithm
takes all (or |
suffix |
(character) The suffix to name the new columns. If set to "" (the default), the taxa_ranks algorithm is used without suffix. |
min_id |
(default: 95) the identity percent to take into account a references taxa |
min_bit_score |
(default: 50) the minimum bit score to take into account a references taxa |
min_cover |
(default: 95) cut of in query cover (%) to keep result |
min_e_value |
(default: 1e-30) cut of in e-value (%) to keep result The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance. |
nb_voting |
(Int, default NULL). The number of taxa to keep before apply a vote to resolve conflict. If NULL all taxa passing the filters (min_id, min_bit_score, min_cover and min_e_value) are selected. |
column_names |
A vector of names for taxonomic ranks. Must correspond to names in the ref_fasta files. |
vote_algorithm |
the method to vote among "consensus", "rel_majority",
"abs_majority" and "unanimity". See |
strict |
(Logical, default FALSE). See |
nb_agree_threshold |
See |
preference_index |
See |
collapse_string |
See |
replace_collapsed_rank_by_NA |
(Logical, default TRUE) See |
simplify_taxo |
(logical default TRUE). Do we apply the
function |
keep_blast_metrics |
(Logical, default FALSE). If TRUE, the blast metrics ("Query seq. length", "Taxa seq. length", "Alignment length", "% id. match", "e-value", "bit score" and "Query cover") are stored in the tax_table. |
... |
Additional arguments passed on to |
If behavior == "return_matrix" :
If method_algo = "top-hit" a matrix of taxonomic assignation
If method_algo = "vote", a list of two matrix, the first is the raw taxonomic assignation (before vote). The second one is the taxonomic assignation in which conflicts are resolved using vote.
If behavior == "add_to_phyloseq", return a new phyloseq object
Adrien Taudière
## Not run: ref_fasta <- Biostrings::readDNAStringSet(system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE )) mat <- assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "top-hit", min_id = 70, min_e_value = 1e-3, min_cover = 50, min_bit_score = 20 ) head(mat) assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "vote", vote_algorithm = "rel_majority", min_id = 90, min_cover = 50, behavior = "add_to_phyloseq" )@tax_table assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "vote", vote_algorithm = "consensus", replace_collapsed_rank_by_NA = FALSE, min_id = 90, min_cover = 50, behavior = "add_to_phyloseq" )@tax_table ## End(Not run)## Not run: ref_fasta <- Biostrings::readDNAStringSet(system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE )) mat <- assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "top-hit", min_id = 70, min_e_value = 1e-3, min_cover = 50, min_bit_score = 20 ) head(mat) assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "vote", vote_algorithm = "rel_majority", min_id = 90, min_cover = 50, behavior = "add_to_phyloseq" )@tax_table assign_blastn(data_fungi_mini, ref_fasta = ref_fasta, method_algo = "vote", vote_algorithm = "consensus", replace_collapsed_rank_by_NA = FALSE, min_id = 90, min_cover = 50, behavior = "add_to_phyloseq" )@tax_table ## End(Not run)
Mainly a wrapper of dada2::assignTaxonomy() and dada2::assignSpecies()
assign_dada2( physeq = NULL, ref_fasta = NULL, seq2search = NULL, min_bootstrap = 0.5, tryRC = FALSE, taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species", "taxId"), use_assignSpecies = TRUE, trunc_absent_ranks = FALSE, nproc = 1, suffix = "", verbose = TRUE, seq_at_one_time = 2000, allowMultiple = FALSE, from_sintax = FALSE )assign_dada2( physeq = NULL, ref_fasta = NULL, seq2search = NULL, min_bootstrap = 0.5, tryRC = FALSE, taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species", "taxId"), use_assignSpecies = TRUE, trunc_absent_ranks = FALSE, nproc = 1, suffix = "", verbose = TRUE, seq_at_one_time = 2000, allowMultiple = FALSE, from_sintax = FALSE )
physeq |
(required) a |
ref_fasta |
(required) A link to a database in fasta. |
seq2search |
A DNAStringSet object of sequences to search for. Replace the physeq object. |
min_bootstrap |
(Float [0:1], default 0.5), See |
tryRC |
|
taxa_ranks |
(vector of character) names for the column of the taxonomy |
use_assignSpecies |
(logical, default TRUE) Do the Species rank is
obtained using |
trunc_absent_ranks |
(logical, default FALSE) Do ranks present in taxa_ranks but not present in the database are removed ? |
nproc |
(Float [0:1], default 0.5) |
suffix |
(character) The suffix to name the new columns. Default to "_idtaxa". |
verbose |
(logical). If TRUE, print additional information. |
seq_at_one_time |
How many sequences are treated at one time.
See param |
allowMultiple |
(logical, default FALSE). Unchanged from
|
from_sintax |
(logical, default FALSE). Set to TRUE
if the ref_fasta database is in sintax format. See |
Either a an object of class phyloseq (if physeq is not NULL),
or a taxonomic table if seq2search is used in place of physeq
## Not run: data_fungi_mini2 <- assign_dada2(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), suffix = "_dada2", from_sintax = TRUE ) ## End(Not run)## Not run: data_fungi_mini2 <- assign_dada2(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), suffix = "_dada2", from_sintax = TRUE ) ## End(Not run)
IdTaxa
This function is basically a wrapper of functions DECIPHER::IdTaxa() and
DECIPHER::LearnTaxa(), please cite the DECIPHER package if you use this
function. Note that if you want to specify parameters for the learning step
you must used the trainingSet param instead of the a fasta_for_training. The
training file can be obtain using the function learn_idtaxa().
It requires:
either a physeq or seq2search object.
either a trainingSet or a fasta_for_training
assign_idtaxa( physeq, trainingSet = NULL, seq2search = NULL, fasta_for_training = NULL, behavior = "return_matrix", threshold = 60, column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), suffix = "_idtaxa", nproc = 1, unite = FALSE, verbose = TRUE, ... )assign_idtaxa( physeq, trainingSet = NULL, seq2search = NULL, fasta_for_training = NULL, behavior = "return_matrix", threshold = 60, column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), suffix = "_idtaxa", nproc = 1, unite = FALSE, verbose = TRUE, ... )
physeq |
(required) a |
trainingSet |
An object of class Taxa and subclass Train compatible with the class of test. |
seq2search |
A DNAStringSet object of sequences to search for. Replace the physeq object. |
fasta_for_training |
A fasta file (can be gzip) to train the trainingSet
using the function The reference database must contain taxonomic information in the header of each sequence in the form of a string starting with ";tax=" and followed by a comma-separated list of up to nine taxonomic identifiers. The only exception is if |
behavior |
Either "return_matrix" (default), or "add_to_phyloseq":
|
threshold |
(Int, default 60) Numeric specifying the confidence at which
to truncate the output taxonomic classifications.
Lower values of threshold will classify deeper into the taxonomic tree at
the expense of accuracy, and vise-versa for higher values of threshold. See
|
column_names |
(vector of character) names for the column of the taxonomy |
suffix |
(character) The suffix to name the new columns. Default to "_idtaxa". |
nproc |
(default: 1) Set to number of cpus/processors to use |
unite |
(logical, default FALSE). If set to TRUE, the fasta_for_training file is formatted from UNITE format to sintax one, needed in fasta_for_training. Only used if trainingSet is NULL. |
verbose |
(logical). If TRUE, print additional information. |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to DECIPHER::IdTaxa() if you
use this function.
Either a new phyloseq object with additional information in the @tax_table slot or a list of two objects if behavior is "return_matrix"
Adrien Taudière
assign_sintax(), add_new_taxonomy_pq(), assign_vsearch_lca(), assign_blastn()
## Not run: # /!\ The value of threshold must be change for real database (recommend # value are between 50 and 70). data_fungi_mini_new <- assign_idtaxa(data_fungi_mini, fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), threshold = 20, behavior = "add_to_phyloseq" ) result_idtaxa <- assign_idtaxa(data_fungi_mini, fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), threshold = 20 ) plot(result_idtaxa$idtaxa_raw) ## End(Not run)## Not run: # /!\ The value of threshold must be change for real database (recommend # value are between 50 and 70). data_fungi_mini_new <- assign_idtaxa(data_fungi_mini, fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), threshold = 20, behavior = "add_to_phyloseq" ) result_idtaxa <- assign_idtaxa(data_fungi_mini, fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ), threshold = 20 ) plot(result_idtaxa$idtaxa_raw) ## End(Not run)
Use the MMseqs2 software to assign taxonomy to sequences.
The preferred usage is to provide a reference FASTA file in SINTAX format
via ref_fasta. The function builds a temporary MMseqs2 taxonomy database
from the SINTAX headers and then runs mmseqs easy-taxonomy with the
requested --lca-mode, giving the same LCA behaviour as the database
path.
Alternatively, a pre-built MMseqs2 database with NCBI taxonomy can be
passed via the database parameter (created via mmseqs createdb +
mmseqs createtaxdb, or downloaded with mmseqs databases). In this
case, the MMseqs2 native easy-taxonomy LCA workflow is used. See the
MMseqs2 wiki for details.
assign_mmseqs2( physeq = NULL, ref_fasta = NULL, database = NULL, seq2search = NULL, mmseqs2path = find_mmseqs2(), behavior = c("return_matrix", "add_to_phyloseq"), suffix = "_mmseqs2", lca_mode = 3, lca_ranks = c("superkingdom", "phylum", "class", "order", "family", "genus", "species"), column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), search_type = 3, sensitivity = NULL, min_seq_id = NULL, e_value = NULL, max_accept = 5, nproc = 1, clean_pq = TRUE, simplify_taxo = TRUE, keep_temporary_files = FALSE, verbose = FALSE, cmd_args = "" )assign_mmseqs2( physeq = NULL, ref_fasta = NULL, database = NULL, seq2search = NULL, mmseqs2path = find_mmseqs2(), behavior = c("return_matrix", "add_to_phyloseq"), suffix = "_mmseqs2", lca_mode = 3, lca_ranks = c("superkingdom", "phylum", "class", "order", "family", "genus", "species"), column_names = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), search_type = 3, sensitivity = NULL, min_seq_id = NULL, e_value = NULL, max_accept = 5, nproc = 1, clean_pq = TRUE, simplify_taxo = TRUE, keep_temporary_files = FALSE, verbose = FALSE, cmd_args = "" )
physeq |
(required) a |
ref_fasta |
Either a Biostrings::DNAStringSet object or a path
to a FASTA file in SINTAX format (taxonomy in headers after
|
database |
(optional) Path to a pre-built MMseqs2 database with
NCBI taxonomy information. Only used if |
seq2search |
(optional) A Biostrings::DNAStringSet object. Use
instead of |
mmseqs2path |
Path to the |
behavior |
Either
|
suffix |
(character) Suffix appended to new taxonomy column names
(default: |
lca_mode |
(integer) The LCA mode used by MMseqs2:
|
lca_ranks |
Character vector of NCBI taxonomy rank names passed
to |
column_names |
Character vector of output column names, must be
the same length as |
search_type |
(integer) MMseqs2 search type:
|
sensitivity |
(numeric, optional) Search sensitivity ( |
min_seq_id |
(numeric, optional) Minimum sequence identity
(0–1). If |
e_value |
(numeric, optional) Maximum E-value threshold ( |
max_accept |
(integer, optional) Maximum number of hits accepted per
query ( |
nproc |
(integer) Number of threads (default: 1). |
clean_pq |
(logical) Clean the phyloseq object before
searching? (default: |
simplify_taxo |
(logical) Apply |
keep_temporary_files |
(logical) Keep intermediate files
for debugging? (default: |
verbose |
(logical) Print progress messages? (default: |
cmd_args |
(character) Additional arguments appended to the MMseqs2 command. |
This function is mainly a wrapper of the work of others. Please cite MMseqs2: Mirdita M, Steinegger M, Breitwieser F, Soding J, Levy Karin E: Fast and sensitive taxonomic assignment to metagenomic contigs. Bioinformatics (2021).
If behavior == "return_matrix": a tibble with
columns taxa_names and one column per rank.
If behavior == "add_to_phyloseq": a new phyloseq object with
amended tax_table.
Adrien Taudière
assign_blastn(), assign_sintax(), assign_vsearch_lca()
## Not run: ref_fasta <- Biostrings::readDNAStringSet(system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE )) # Preferred usage: provide a SINTAX-formatted FASTA file. # The function searches with easy-search and parses SINTAX headers. res <- assign_mmseqs2(data_fungi_mini, ref_fasta = ref_fasta) head(res) # Add taxonomy to phyloseq: physeq_new <- assign_mmseqs2( data_fungi_mini, ref_fasta = ref_fasta, behavior = "add_to_phyloseq" ) ## End(Not run)## Not run: ref_fasta <- Biostrings::readDNAStringSet(system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar", mustWork = TRUE )) # Preferred usage: provide a SINTAX-formatted FASTA file. # The function searches with easy-search and parses SINTAX headers. res <- assign_mmseqs2(data_fungi_mini, ref_fasta = ref_fasta) head(res) # Add taxonomy to phyloseq: physeq_new <- assign_mmseqs2( data_fungi_mini, ref_fasta = ref_fasta, behavior = "add_to_phyloseq" ) ## End(Not run)
Please cite Vsearch if you use this function to assign taxonomy.
assign_sintax( physeq = NULL, ref_fasta = NULL, seq2search = NULL, behavior = c("return_matrix", "add_to_phyloseq", "return_cmd"), vsearchpath = find_vsearch(), clean_pq = TRUE, nproc = 1, suffix = "", taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), min_bootstrap = 0.5, keep_temporary_files = FALSE, verbose = FALSE, temporary_fasta_file = paste0(tempdir(), "/temp.fasta"), cmd_args = "--sintax_random", too_few = "align_start", too_many = "drop" )assign_sintax( physeq = NULL, ref_fasta = NULL, seq2search = NULL, behavior = c("return_matrix", "add_to_phyloseq", "return_cmd"), vsearchpath = find_vsearch(), clean_pq = TRUE, nproc = 1, suffix = "", taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), min_bootstrap = 0.5, keep_temporary_files = FALSE, verbose = FALSE, temporary_fasta_file = paste0(tempdir(), "/temp.fasta"), cmd_args = "--sintax_random", too_few = "align_start", too_many = "drop" )
physeq |
(required) a |
ref_fasta |
(required) A link to a database in vsearch format The reference database must contain taxonomic information in the header of each sequence in the form of a string starting with ";tax=" and followed by a comma-separated list of up to nine taxonomic identifiers. Each taxonomic identifier must start with an indication of the rank by one of the letters d (for domain) k (kingdom), p (phylum), c (class), o (order), f (family), g (genus), s (species), or t (strain). The letter is followed by a colon (:) and the name of that rank. Commas and semicolons are not allowed in the name of the rank. Non-ascii characters should be avoided in the names. Example: \>X80725_S000004313;tax=d:Bacteria,p:Proteobacteria,c:Gammaproteobacteria,o:Enterobacteriales,f:Enterobacteriaceae,g:Escherichia/Shigella,s:Escherichia_coli,t:str._K-12_substr._MG1655 |
seq2search |
A DNAStringSet object of sequences to search for. Replace the physeq object. |
behavior |
Either "return_matrix" (default), "return_cmd", or "add_to_phyloseq":
|
vsearchpath |
(default: "vsearch") path to vsearch |
clean_pq |
(logical, default TRUE) If set to TRUE, empty samples and empty ASV are discarded before clustering. |
nproc |
(default: 1) Set to number of cpus/processors to use |
suffix |
(character) The suffix to name the new columns. If set to "" (the default), the taxa_ranks algorithm is used without suffix. |
taxa_ranks |
A list with the name of the taxonomic rank present in ref_fasta |
min_bootstrap |
(Float [0:1], default 0.5) Minimum bootstrap value to inform taxonomy. For each bootstrap below the min_bootstrap value, the taxonomy information is set to NA. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files?
|
verbose |
(logical). If TRUE, print additional information. |
temporary_fasta_file |
The path of a temporary fasta file
(default in |
cmd_args |
Additional arguments passed on to vsearch sintax cmd. By default cmd_args is equal to "–sintax_random" as recommended by Torognes. |
too_few |
(default value "align_start") see |
too_many |
(default value "drop") see |
This function is mainly a wrapper of the work of others. Please cite vsearch.
See param behavior
Adrien Taudière
assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), behavior = "return_cmd" ) data_fungi_mini_new <- assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), behavior = "add_to_phyloseq" ) assignation_results <- assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar") ) left_join( tidyr::pivot_longer(assignation_results$taxo_value, -taxa_names), tidyr::pivot_longer(assignation_results$taxo_bootstrap, -taxa_names), by = join_by(taxa_names, name), suffix = c("rank", "bootstrap") ) |> mutate(name = factor(name, levels = c( "Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) )) |> ggplot(aes(valuebootstrap, valuerank, fill = name )) + geom_jitter(alpha = 0.8, aes(color = name)) + geom_boxplot(alpha = 0.3)assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), behavior = "return_cmd" ) data_fungi_mini_new <- assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), behavior = "add_to_phyloseq" ) assignation_results <- assign_sintax(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar") ) left_join( tidyr::pivot_longer(assignation_results$taxo_value, -taxa_names), tidyr::pivot_longer(assignation_results$taxo_bootstrap, -taxa_names), by = join_by(taxa_names, name), suffix = c("rank", "bootstrap") ) |> mutate(name = factor(name, levels = c( "Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) )) |> ggplot(aes(valuebootstrap, valuerank, fill = name )) + geom_jitter(alpha = 0.8, aes(color = name)) + geom_boxplot(alpha = 0.3)
Please cite Vsearch and stampa if you use this function to assign taxonomy.
If top_hits_only is TRUE, the algorithm is the one of stampa.
If top_hits_only is FALSE and vote_algorithm is NULL, you need to carefully define maxaccept, id and lca_cutoff parameters.
The algorithm is internal to vsearch using the lcaout output.
If top_hits_only is FALSE and vote_algorithm is not NULL, conflict among the
list of taxonomic assignations is resolve using the function resolve_vector_ranks().
The possible values for vote_algorithm are "consensus", "rel_majority",
"abs_majority" and "unanimity". See resolve_vector_ranks() for more details.
assign_vsearch_lca( physeq = NULL, ref_fasta = NULL, seq2search = NULL, behavior = c("return_matrix", "add_to_phyloseq", "return_cmd"), vsearchpath = find_vsearch(), clean_pq = TRUE, taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), nproc = 1, suffix = "_sintax", id = 0.5, lca_cutoff = 1, maxrejects = 32, top_hits_only = TRUE, maxaccepts = 0, keep_temporary_files = FALSE, verbose = TRUE, temporary_fasta_file = paste0(tempdir(), "/temp.fasta"), cmd_args = "", too_few = "align_start", vote_algorithm = NULL, nb_voting = NULL, strict = FALSE, nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = TRUE, simplify_taxo = TRUE, keep_vsearch_score = FALSE )assign_vsearch_lca( physeq = NULL, ref_fasta = NULL, seq2search = NULL, behavior = c("return_matrix", "add_to_phyloseq", "return_cmd"), vsearchpath = find_vsearch(), clean_pq = TRUE, taxa_ranks = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species"), nproc = 1, suffix = "_sintax", id = 0.5, lca_cutoff = 1, maxrejects = 32, top_hits_only = TRUE, maxaccepts = 0, keep_temporary_files = FALSE, verbose = TRUE, temporary_fasta_file = paste0(tempdir(), "/temp.fasta"), cmd_args = "", too_few = "align_start", vote_algorithm = NULL, nb_voting = NULL, strict = FALSE, nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = TRUE, simplify_taxo = TRUE, keep_vsearch_score = FALSE )
physeq |
(required) a |
ref_fasta |
(required) A link to a database in vsearch format The reference database must contain taxonomic information in the header of each sequence in the form of a string starting with ";tax=" and followed by a comma-separated list of up to nine taxonomic identifiers. Each taxonomic identifier must start with an indication of the rank by one of the letters d (for domain) k (kingdom), p (phylum), c (class), o (order), f (family), g (genus), s (species), or t (strain). The letter is followed by a colon (:) and the name of that rank. Commas and semicolons are not allowed in the name of the rank. Non-ascii characters should be avoided in the names. Example: \>X80725_S000004313;tax=d:Bacteria,p:Proteobacteria,c:Gammaproteobacteria,o:Enterobacteriales,f:Enterobacteriaceae,g:Escherichia/Shigella,s:Escherichia_coli,t:str._K-12_substr._MG1655 |
seq2search |
A DNAStringSet object of sequences to search for. Replace the physeq object. |
behavior |
Either "return_matrix" (default), "return_cmd", or "add_to_phyloseq":
|
vsearchpath |
(default: "vsearch") path to vsearch |
clean_pq |
(logical, default TRUE) If set to TRUE, empty samples and empty ASV are discarded before clustering. |
taxa_ranks |
A list with the name of the taxonomic rank present in ref_fasta |
nproc |
(int, default: 1) Set to number of cpus/processors to use |
suffix |
(character) The suffix to name the new columns. If set to "" (the default), the taxa_ranks algorithm is used without suffix. |
id |
(Float [0:1] default 0.5). Default value is based on
stampa.
See Vsearch Manual for parameter |
lca_cutoff |
(int, default 1). Fraction of matching hits
required for the last common ancestor (LCA) output. For example, a value
of 0.9 imply that if less than 10% of assigned species are not congruent
the taxonomy is filled.
Default value is based on stampa.
See Vsearch Manual for parameter Text from vsearch manual : "Adjust the fraction of matching hits required for the last common ancestor (LCA) output with the –lcaout option during searches. The default value is 1.0 which requires all hits to match at each taxonomic rank for that rank to be included. If a lower cutoff value is used, e.g. 0.95, a small fraction of non-matching hits are allowed while that rank will still be reported. The argument to this option must be larger than 0.5, but not larger than 1.0" |
maxrejects |
(int, default: 32)
Maximum number of non-matching target sequences to consider before
stopping the search for a given query.
Default value is based on stampa
See Vsearch Manual for parameter |
top_hits_only |
(Logical, default TRUE)
Only the top hits with an equally high percentage of identity between the query and
database sequence sets are written to the output. If you set top_hits_only
you may need to set a lower |
maxaccepts |
(int, default: 0)
Default value is based on stampa.
Maximum number of matching target sequences to accept before stopping the search
for a given query.
See Vsearch Manual for parameter |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files?
|
verbose |
(logical). If TRUE, print additional information. |
temporary_fasta_file |
The path of a temporary fasta file
(default in |
cmd_args |
Additional arguments passed on to vsearch usearch_global cmd. |
too_few |
(default value "align_start") see |
vote_algorithm |
(default NULL) the method to vote among "consensus", "rel_majority",
"abs_majority" and "unanimity". See |
nb_voting |
(Int, default NULL). The number of taxa to keep before apply a vote to resolve conflict. If NULL all taxa passing the filters (min_id, min_bit_score, min_cover and min_e_value) are selected. |
strict |
(Logical, default FALSE). See |
nb_agree_threshold |
See |
preference_index |
See |
collapse_string |
See |
replace_collapsed_rank_by_NA |
(Logical, default TRUE) See |
simplify_taxo |
(logical default TRUE). Do we apply the
function |
keep_vsearch_score |
(Logical, default FALSE). If TRUE, the mean and sd of id score are stored in the tax_table. |
This function is mainly a wrapper of the work of others. Please cite vsearch and stampa
See param behavior
Adrien Taudière
assign_sintax(), add_new_taxonomy_pq()
data_fungi_mini_new <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), lca_cutoff = 0.9, behavior = "add_to_phyloseq" ) ## Not run: data_fungi_mini_new2 <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), id = 0.6, behavior = "add_to_phyloseq", top_hits_only = FALSE ) data_fungi_mini_new3 <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), id = 0.5, behavior = "add_to_phyloseq", top_hits_only = FALSE, vote_algorithm = "rel_majority" ) ## End(Not run)data_fungi_mini_new <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), lca_cutoff = 0.9, behavior = "add_to_phyloseq" ) ## Not run: data_fungi_mini_new2 <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), id = 0.6, behavior = "add_to_phyloseq", top_hits_only = FALSE ) data_fungi_mini_new3 <- assign_vsearch_lca(data_fungi_mini, ref_fasta = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar"), id = 0.5, behavior = "add_to_phyloseq", top_hits_only = FALSE, vote_algorithm = "rel_majority" ) ## End(Not run)
Graphical representation of distribution of taxa across two samples.
biplot_pq( physeq, fact = NULL, merge_sample_by = NULL, rarefy_after_merging = FALSE, rngseed = FALSE, verbose = TRUE, inverse_side = FALSE, left_name = NULL, left_name_col = "#4B3E1E", left_fill = "#4B3E1E", left_col = "#4B3E1E", right_name = NULL, right_name_col = "#1d2949", right_fill = "#1d2949", right_col = "#1d2949", log10trans = TRUE, nudge_y = c(0.3, 0.3), geom_label = FALSE, text_size = 3, size_names = 5, y_names = NA, ylim_modif = c(1, 1), nb_samples_info = TRUE, split_by_sample = FALSE, sample_border_col = "#d4d0acff", sample_border_width = 0.3, color_rank = NULL, taxa_names_rank = NULL, plotly_version = FALSE, ... )biplot_pq( physeq, fact = NULL, merge_sample_by = NULL, rarefy_after_merging = FALSE, rngseed = FALSE, verbose = TRUE, inverse_side = FALSE, left_name = NULL, left_name_col = "#4B3E1E", left_fill = "#4B3E1E", left_col = "#4B3E1E", right_name = NULL, right_name_col = "#1d2949", right_fill = "#1d2949", right_col = "#1d2949", log10trans = TRUE, nudge_y = c(0.3, 0.3), geom_label = FALSE, text_size = 3, size_names = 5, y_names = NA, ylim_modif = c(1, 1), nb_samples_info = TRUE, split_by_sample = FALSE, sample_border_col = "#d4d0acff", sample_border_width = 0.3, color_rank = NULL, taxa_names_rank = NULL, plotly_version = FALSE, ... )
physeq |
(required) a |
fact |
(default: NULL) Name of the factor in |
merge_sample_by |
(default: NULL) if not |
rarefy_after_merging |
Rarefy each sample after merging by the modalities merge_sample_by |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
inverse_side |
Inverse the side (put the right modality in the left side). |
left_name |
Name fo the left sample. |
left_name_col |
Color for the left name |
left_fill |
Fill fo the left sample. |
left_col |
Color fo the left sample. |
right_name |
Name fo the right sample. |
right_name_col |
Color for the right name |
right_fill |
Fill fo the right sample. |
right_col |
Color fo the right sample. |
log10trans |
(logical) Does abundancy is log10 transformed ? |
nudge_y |
A parameter to control the y position of abundancy values. If a vector of two values are set. The first value is for the left side. and the second value for the right one. If one value is set, this value is used for both side. |
geom_label |
(default: FALSE, logical) if TRUE use the |
text_size |
size for the number of sequences |
size_names |
size for the names of the 2 samples |
y_names |
y position for the names of the 2 samples. If NA (default), computed using the maximum abundances values. |
ylim_modif |
vector of two values. Modificator (by a multiplication) of ylim. If one value is set, this value is used for both limits. |
nb_samples_info |
(default: TRUE, logical) if TRUE and merge_sample_by is set, add the number of samples merged for both levels. |
split_by_sample |
(default: FALSE, logical) if TRUE and
|
sample_border_col |
(default: "white") Color of the border between
sample segments when |
sample_border_width |
(default: 0.3) Width of the border between
sample segments when |
color_rank |
(default: NULL) Name of a taxonomic rank in |
taxa_names_rank |
(default: NULL) Name of a taxonomic rank in
|
plotly_version |
If TRUE, use |
... |
Other arguments for the ggplot function |
A plot
Adrien Taudière
data_fungi_2Height <- subset_samples(data_fungi_mini, Height %in% c("Low", "High")) biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height") biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height", split_by_sample = TRUE ) biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height", color_rank = "Order", taxa_names_rank = "Genus" )data_fungi_2Height <- subset_samples(data_fungi_mini, Height %in% c("Low", "High")) biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height") biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height", split_by_sample = TRUE ) biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height", color_rank = "Order", taxa_names_rank = "Genus" )
refseq slot of a phyloseq-class
object against a custom database.Use the blast software.
blast_pq( physeq, fasta_for_db = NULL, database = NULL, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = TRUE, nproc = 1, args_makedb = NULL, args_blastn = NULL, keep_temporary_files = FALSE )blast_pq( physeq, fasta_for_db = NULL, database = NULL, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = TRUE, nproc = 1, args_makedb = NULL, args_blastn = NULL, keep_temporary_files = FALSE )
physeq |
(required) a |
fasta_for_db |
Either a DNAStringSet object or a path to a fasta file to make the blast database. |
database |
path to a blast database |
blastpath |
path to blast program |
id_cut |
(default: 90) cut of in identity percent to keep result |
bit_score_cut |
(default: 50) cut of in bit score to keep result The higher the bit-score, the better the sequence similarity. The bit-score is the requires size of a sequence database in which the current match could be found just by chance. The bit-score is a log2 scaled and normalized raw-score. Each increase by one doubles the required database size (2bit-score). |
min_cover_cut |
(default: 50) cut of in query cover (%) to keep result |
e_value_cut |
(default: 1e-30) cut of in e-value (%) to keep result The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance. |
unique_per_seq |
(logical, default FALSE) if TRUE only return the better match (higher bit score) for each sequence |
score_filter |
(logical, default TRUE) does results are filter by score? If
FALSE, |
nproc |
(default: 1) Set to number of cpus/processors to use for blast (args -num_threads for blastn command) |
args_makedb |
Additional arguments passed on to makeblastdb command |
args_blastn |
Additional arguments passed on to blastn command |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files
|
a blast table
blast_to_phyloseq() to use refseq
slot as a database
## Not run: blast_pq(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)## Not run: blast_pq(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)
derep-class
object.Use the blast software.
blast_to_derep( derep, seq2search, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = FALSE, list_no_output_query = FALSE, min_length_seq = 200, args_makedb = NULL, args_blastn = NULL, nproc = 1, keep_temporary_files = FALSE )blast_to_derep( derep, seq2search, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = FALSE, list_no_output_query = FALSE, min_length_seq = 200, args_makedb = NULL, args_blastn = NULL, nproc = 1, keep_temporary_files = FALSE )
derep |
The result of |
seq2search |
(required) path to a fasta file defining the sequences you want to blast against the taxa (ASV, OTU) sequences from the physeq object. |
blastpath |
path to blast program |
id_cut |
(default: 90) cut of in identity percent to keep result |
bit_score_cut |
(default: 50) cut of in bit score to keep result The higher the bit-score, the better the sequence similarity. The bit-score is the requires size of a sequence database in which the current match could be found just by chance. The bit-score is a log2 scaled and normalized raw-score. Each increase by one doubles the required database size (2bit-score). |
min_cover_cut |
(default: 50) cut of in query cover (%) to keep result |
e_value_cut |
(default: 1e-30) cut of in e-value (%) to keep result The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance. |
unique_per_seq |
(logical, default FALSE) if TRUE only return the better match (higher bit score) for each sequence |
score_filter |
(logical, default TRUE) does results are filter by score? If
FALSE, |
list_no_output_query |
(logical) does the result table include
query sequences for which |
min_length_seq |
(default: 200) Removed sequences with less than
|
args_makedb |
Additional arguments passed on to makeblastdb command |
args_blastn |
Additional arguments passed on to blastn command |
nproc |
(default: 1) Set to number of cpus/processors to use for blast (args -num_threads for blastn command) |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files :
|
A blast table
Adrien Taudière
blast_pq() to use refseq slot as query sequences
against un custom database and blast_to_phyloseq() to use
refseq slot as a database
## Not run: # derep_list is the result of dada2::derepFastq() derep_list <- list(dada2::derepFastq( system.file("extdata", "ex.fastq", package = "MiscMetabar", mustWork = TRUE ) )) blast_to_derep( derep = derep_list, seq2search = system.file("extdata", "ex.fasta", package = "MiscMetabar" ) ) ## End(Not run)## Not run: # derep_list is the result of dada2::derepFastq() derep_list <- list(dada2::derepFastq( system.file("extdata", "ex.fastq", package = "MiscMetabar", mustWork = TRUE ) )) blast_to_derep( derep = derep_list, seq2search = system.file("extdata", "ex.fasta", package = "MiscMetabar" ) ) ## End(Not run)
refseq slot of a phyloseq-class
object.Use the blast software.
blast_to_phyloseq( physeq, seq2search, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = TRUE, list_no_output_query = FALSE, args_makedb = NULL, args_blastn = NULL, nproc = 1, keep_temporary_files = FALSE )blast_to_phyloseq( physeq, seq2search, blastpath = NULL, id_cut = 90, bit_score_cut = 50, min_cover_cut = 50, e_value_cut = 1e-30, unique_per_seq = FALSE, score_filter = TRUE, list_no_output_query = FALSE, args_makedb = NULL, args_blastn = NULL, nproc = 1, keep_temporary_files = FALSE )
physeq |
(required) a |
seq2search |
(required) path to a fasta file defining the sequences you want to blast against the taxa (ASV, OTU) sequences from the physeq object. |
blastpath |
path to blast program |
id_cut |
(default: 90) cut of in identity percent to keep result |
bit_score_cut |
(default: 50) cut of in bit score to keep result The higher the bit-score, the better the sequence similarity. The bit-score is the requires size of a sequence database in which the current match could be found just by chance. The bit-score is a log2 scaled and normalized raw-score. Each increase by one doubles the required database size (2bit-score). |
min_cover_cut |
(default: 50) cut of in query cover (%) to keep result |
e_value_cut |
(default: 1e-30) cut of in e-value (%) to keep result The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance. |
unique_per_seq |
(logical, default FALSE) if TRUE only return the better match (higher bit score) for each sequence |
score_filter |
(logical, default TRUE) does results are filter by score? If
FALSE, |
list_no_output_query |
(logical) does the result table include
query sequences for which |
args_makedb |
Additional arguments passed on to makeblastdb command |
args_blastn |
Additional arguments passed on to blastn command |
nproc |
(default: 1) Set to number of cpus/processors to use for blast (args -num_threads for blastn command) |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files
|
the blast table
blast_pq() to use refseq slot as query sequences
against un custom database.
## Not run: blastpath <- "...YOUR_PATH_TO_BLAST..." blast_to_phyloseq(data_fungi, seq2search = system.file("extdata", "ex.fasta", package = "MiscMetabar", mustWork = TRUE ), blastpath = blastpath ) ## End(Not run)## Not run: blastpath <- "...YOUR_PATH_TO_BLAST..." blast_to_phyloseq(data_fungi, seq2search = system.file("extdata", "ex.fasta", package = "MiscMetabar", mustWork = TRUE ), blastpath = blastpath ) ## End(Not run)
This function build tree phylogenetic tree and if nb_bootstrap is set, it build also the 3 corresponding bootstrapped tree.
Default parameters are based on doi:10.12688/f1000research.8986.2 and phangorn vignette Estimating phylogenetic trees with phangorn. You should understand your data, especially the markers, before using this function.
Note that phylogenetic reconstruction with markers used for metabarcoding are not robust. You must verify the robustness of your phylogenetic tree using taxonomic classification (see vignette Tree visualization) and bootstrap or multi-tree visualization
build_phytree_pq( physeq, nb_bootstrap = 0, model = "GTR", optInv = TRUE, optGamma = TRUE, rearrangement = "NNI", control = phangorn::pml.control(trace = 0), optNni = TRUE, multicore = FALSE, ... )build_phytree_pq( physeq, nb_bootstrap = 0, model = "GTR", optInv = TRUE, optGamma = TRUE, rearrangement = "NNI", control = phangorn::pml.control(trace = 0), optNni = TRUE, multicore = FALSE, ... )
physeq |
(required) a |
nb_bootstrap |
(default 0): If a positive number is set,
the function also build 3 bootstrapped trees using |
model |
allows to choose an amino acid models or nucleotide model,
see |
optInv |
Logical value indicating whether topology gets optimized
(NNI). See |
optGamma |
Logical value indicating whether gamma rate parameter gets
optimized. See |
rearrangement |
type of tree tree rearrangements to perform, one of
"NNI", "stochastic" or "ratchet"
see |
control |
A list of parameters for controlling the fitting process.
see |
optNni |
Logical value indicating whether topology gets optimized (NNI).
see |
multicore |
(logical) whether models should estimated in parallel.
see |
... |
Other params for be passed on to
|
This function is mainly a wrapper of the work of others.
Please make a reference to phangorn package if you
use this function.
A list of phylogenetic tree
Adrien Taudière
if (requireNamespace("phangorn")) { set.seed(22) df <- subset_taxa_pq(data_fungi_mini, taxa_sums(data_fungi_mini) > 9000) df_tree <- build_phytree_pq(df, nb_bootstrap = 2) plot(df_tree$UPGMA) phangorn::plotBS(df_tree$UPGMA, df_tree$UPGMA_bs, main = "UPGMA") plot(df_tree$NJ, "unrooted") plot(df_tree$ML) phangorn::plotBS(df_tree$ML$tree, df_tree$ML_bs, p = 20, frame = "circle") phangorn::plotBS( df_tree$ML$tree, df_tree$ML_bs, p = 20, frame = "circle", method = "TBE" ) plot(phangorn::consensusNet(df_tree$ML_bs)) plot(phangorn::consensusNet(df_tree$NJ_bs)) ps_tree <- merge_phyloseq(df, df_tree$ML$tree) }if (requireNamespace("phangorn")) { set.seed(22) df <- subset_taxa_pq(data_fungi_mini, taxa_sums(data_fungi_mini) > 9000) df_tree <- build_phytree_pq(df, nb_bootstrap = 2) plot(df_tree$UPGMA) phangorn::plotBS(df_tree$UPGMA, df_tree$UPGMA_bs, main = "UPGMA") plot(df_tree$NJ, "unrooted") plot(df_tree$ML) phangorn::plotBS(df_tree$ML$tree, df_tree$ML_bs, p = 20, frame = "circle") phangorn::plotBS( df_tree$ML$tree, df_tree$ML_bs, p = 20, frame = "circle", method = "TBE" ) plot(phangorn::consensusNet(df_tree$ML_bs)) plot(phangorn::consensusNet(df_tree$NJ_bs)) ps_tree <- merge_phyloseq(df, df_tree$ML$tree) }
Use the VSEARCH software.
chimera_detection_vs( seq2search, nb_seq, vsearchpath = find_vsearch(), abskew = 2, min_seq_length = 100, vsearch_args = "--fasta_width 0", keep_temporary_files = FALSE )chimera_detection_vs( seq2search, nb_seq, vsearchpath = find_vsearch(), abskew = 2, min_seq_length = 100, vsearch_args = "--fasta_width 0", keep_temporary_files = FALSE )
seq2search |
(required) a list of DNA sequences coercible by function
|
nb_seq |
(required) a numeric vector giving the number of sequences for each DNA sequences |
vsearchpath |
(default: "vsearch") path to vsearch |
abskew |
(int, default 2) The abundance skew is used to distinguish in a three way alignment which sequence is the chimera and which are the parents. The assumption is that chimeras appear later in the PCR amplification process and are therefore less abundant than their parents. The default value is 2.0, which means that the parents should be at least 2 times more abundant than their chimera. Any positive value equal or greater than 1.0 can be used. |
min_seq_length |
(int, default 100)) Minimum length of sequences to be part of the analysis |
vsearch_args |
(default "–fasta_width 0") A list of other args for vsearch command |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files ?
|
This function is mainly a wrapper of the work of others. Please make vsearch.
A list of 3 including non-chimera taxa ($non_chimera), chimera taxa
($chimera) and bordeline taxa ($borderline)
Adrien Taudière
chimera_removal_vs(), dada2::removeBimeraDenovo()
chimera_detection_vs( seq2search = data_fungi@refseq, nb_seq = taxa_sums(data_fungi) )chimera_detection_vs( seq2search = data_fungi@refseq, nb_seq = taxa_sums(data_fungi) )
Use the VSEARCH software.
chimera_removal_vs(object, type = "Discard_only_chim", clean_pq = FALSE, ...)chimera_removal_vs(object, type = "Discard_only_chim", clean_pq = FALSE, ...)
object |
(required) A phyloseq-class object or one of dada, derep,
data.frame or list coercible to sequences table using the
function |
type |
(default "Discard_only_chim"). The type define the type of filtering.
|
clean_pq |
(logical; default FALSE) If TRUE, return the phyloseq object
after cleaning using the default parameter of |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others. Please cite vsearch.
I/ a sequences tables if object is of class dada, derep, data.frame or list.
II/ a phyloseq object without (or with if type = 'Select_only_chim') chimeric taxa
Adrien Taudière
chimera_detection_vs(), dada2::removeBimeraDenovo()
data_fungi_nochim <- chimera_removal_vs(data_fungi) ## Not run: # Adding a chimeric sequence for the example data_fungi_with_chim <- data_fungi data_fungi_with_chim@refseq["ASV1710"] <- Biostrings::xscat( Biostrings::subseq(data_fungi_with_chim@refseq[1], start = 1, end = 150), Biostrings::subseq(data_fungi_with_chim@refseq[4], start = 151, end = 300) ) data_fungi_nochim <- chimera_removal_vs(data_fungi) # Higher value of abskew parameter is less stringent data_fungi_nochim_16 <- chimera_removal_vs(data_fungi, abskew = 16, min_seq_length = 10 ) # Potential Chimeric ASVs detected by vsearch chim_asv <- taxa_names(data_fungi_with_chim)[!taxa_names(data_fungi_with_chim) %in% taxa_names(data_fungi_nochim)] "ASV1710" %in% chim_asv track_wkflow(list(data_fungi_with_chim, data_fungi_nochim)) data_fungi_nochim2 <- chimera_removal_vs(data_fungi, type = "Select_only_non_chim_seqlen_filtered") data_fungi_chimera <- chimera_removal_vs(data_fungi, type = "Select_only_chim") ## End(Not run)data_fungi_nochim <- chimera_removal_vs(data_fungi) ## Not run: # Adding a chimeric sequence for the example data_fungi_with_chim <- data_fungi data_fungi_with_chim@refseq["ASV1710"] <- Biostrings::xscat( Biostrings::subseq(data_fungi_with_chim@refseq[1], start = 1, end = 150), Biostrings::subseq(data_fungi_with_chim@refseq[4], start = 151, end = 300) ) data_fungi_nochim <- chimera_removal_vs(data_fungi) # Higher value of abskew parameter is less stringent data_fungi_nochim_16 <- chimera_removal_vs(data_fungi, abskew = 16, min_seq_length = 10 ) # Potential Chimeric ASVs detected by vsearch chim_asv <- taxa_names(data_fungi_with_chim)[!taxa_names(data_fungi_with_chim) %in% taxa_names(data_fungi_nochim)] "ASV1710" %in% chim_asv track_wkflow(list(data_fungi_with_chim, data_fungi_nochim)) data_fungi_nochim2 <- chimera_removal_vs(data_fungi, type = "Select_only_non_chim_seqlen_filtered") data_fungi_chimera <- chimera_removal_vs(data_fungi, type = "Select_only_chim") ## End(Not run)
phyloseq-class objectGraphical representation of distribution of taxa across a factor.
circle_pq( physeq = NULL, fact = NULL, taxa = "Order", nproc = 1, add_nb_seq = TRUE, rarefy = FALSE, min_prop_tax = 0.01, min_prop_mod = 0.1, gap_degree = NULL, start_degree = NULL, row_col = NULL, grid_col = NULL, log10trans = FALSE, ... )circle_pq( physeq = NULL, fact = NULL, taxa = "Order", nproc = 1, add_nb_seq = TRUE, rarefy = FALSE, min_prop_tax = 0.01, min_prop_mod = 0.1, gap_degree = NULL, start_degree = NULL, row_col = NULL, grid_col = NULL, log10trans = FALSE, ... )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
taxa |
(default: 'Order') Name of the taxonomic rank of interest |
nproc |
(default 1) Set to number of cpus/processors to use for parallelization |
add_nb_seq |
(logical, default TRUE) Represent the number of sequences or the number of OTUs (add_nb_seq = FALSE) |
rarefy |
(logical) Does each samples modalities need to be rarefy in order to compare them with the same amount of sequences? |
min_prop_tax |
(default: 0.01) The minimum proportion for taxa to be plotted |
min_prop_mod |
(default: 0.1) The minimum proportion for modalities to be plotted |
gap_degree |
Gap between two neighbour sectors. It can be a single value or a vector. If it is a vector, the first value corresponds to the gap after the first sector. |
start_degree |
The starting degree from which the circle begins to draw. Note this degree is measured in the standard polar coordinate which means it is always reverse-clockwise. |
row_col |
Color vector for row |
grid_col |
Grid colors which correspond to sectors. The length of the vector should be either 1 or the number of sectors. It's preferred that grid_col is a named vector of which names correspond to sectors. If it is not a named vector, the order of grid_col corresponds to order of sectors. |
log10trans |
(logical) Should sequence be log10 transformed (more precisely by log10(1+x))? |
... |
Additional arguments passed on to
|
A chordDiagram plot representing the
distribution of OTUs or sequences in the different modalities of the factor
fact
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") circle_pq(GP, "SampleType") ## Not run: circle_pq(GP, "SampleType", add_nb_seq = FALSE) circle_pq(GP, "SampleType", taxa = "Class") ## End(Not run)data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") circle_pq(GP, "SampleType") ## Not run: circle_pq(GP, "SampleType", add_nb_seq = FALSE) circle_pq(GP, "SampleType", taxa = "Class") ## End(Not run)
In addition, this function check for discrepancy (and rename) between (i) taxa names in refseq, taxonomy table and otu_table and between (ii) sample names in sam_data and otu_table.
clean_pq( physeq, remove_empty_samples = TRUE, remove_empty_taxa = TRUE, clean_samples_names = TRUE, silent = FALSE, verbose = FALSE, force_taxa_as_columns = FALSE, force_taxa_as_rows = FALSE, reorder_taxa = FALSE, rename_taxa = FALSE, simplify_taxo = FALSE, prefix_taxa_names = "_Taxa", check_taxonomy = FALSE, tax_remove_border_spaces = FALSE, tax_remove_all_space = FALSE, tax_replace_to_NA = FALSE, tax_redundant_suffix = FALSE, tax_replace_space_with = "_", tax_replace_invisible_chars = FALSE )clean_pq( physeq, remove_empty_samples = TRUE, remove_empty_taxa = TRUE, clean_samples_names = TRUE, silent = FALSE, verbose = FALSE, force_taxa_as_columns = FALSE, force_taxa_as_rows = FALSE, reorder_taxa = FALSE, rename_taxa = FALSE, simplify_taxo = FALSE, prefix_taxa_names = "_Taxa", check_taxonomy = FALSE, tax_remove_border_spaces = FALSE, tax_remove_all_space = FALSE, tax_replace_to_NA = FALSE, tax_redundant_suffix = FALSE, tax_replace_space_with = "_", tax_replace_invisible_chars = FALSE )
physeq |
(required) a |
remove_empty_samples |
(logical) Do you want to remove samples without sequences (this is done after removing empty taxa) |
remove_empty_taxa |
(logical) Do you want to remove taxa without sequences (this is done before removing empty samples) |
clean_samples_names |
(logical) Do you want to clean samples names? |
silent |
(logical) If true, no message are printing. |
verbose |
(logical) Additional informations in the message the verbose parameter overwrite the silent parameter. |
force_taxa_as_columns |
(logical) If true, if the taxa are rows transpose the otu_table and set taxa_are_rows to false |
force_taxa_as_rows |
(logical) If true, if the taxa are columns transpose the otu_table and set taxa_are_rows to true |
reorder_taxa |
(logical) if TRUE the otu_table is ordered by the number of sequences of taxa (ASV, OTU) in descending order. Default to FALSE. |
rename_taxa |
(logical, default FALSE) if TRUE, taxa (ASV, OTU) are renamed by their position in the OTU_table and prefix_taxa_names param (Taxa_1, Taxa_2, ...). Default to FALSE. If rename taxa (ASV, OTU) is true, the taxa (ASV, OTU) names in verbose information can be misleading. |
simplify_taxo |
(logical) if TRUE, correct the taxonomy_table using the
|
prefix_taxa_names |
(default "Taxa_"): the prefix of taxa names (eg. "ASV_" or "OTU_") |
check_taxonomy |
(logical, default FALSE) If TRUE, call
|
tax_remove_border_spaces |
(logical, default FALSE) If TRUE, trim
leading/trailing whitespace from values in the |
tax_remove_all_space |
(logical, default FALSE) If TRUE, replace
internal whitespace (ASCII or Unicode separator) in |
tax_replace_to_NA |
(logical or character, default FALSE) If TRUE,
replace |
tax_redundant_suffix |
(logical or character, default FALSE) If TRUE,
replace redundant |
tax_replace_space_with |
(character, default |
tax_replace_invisible_chars |
(logical, default FALSE) If TRUE,
strip invisible / unusual characters (control chars, zero-width space,
NBSP inside values, ...) from |
A new phyloseq-class object
Adrien Taudière
clean_pq(data_fungi_mini) # Trim leading/trailing whitespace in tax_table values clean_pq(data_fungi_mini, tax_remove_border_spaces = TRUE) # Replace NA-like values (e.g. "unidentified", "NA") with NA clean_pq(data_fungi_mini, tax_replace_to_NA = TRUE) # Drop redundant "_sp" tips clean_pq(data_fungi_mini, tax_redundant_suffix = TRUE)clean_pq(data_fungi_mini) # Trim leading/trailing whitespace in tax_table values clean_pq(data_fungi_mini, tax_remove_border_spaces = TRUE) # Replace NA-like values (e.g. "unidentified", "NA") with NA clean_pq(data_fungi_mini, tax_replace_to_NA = TRUE) # Drop redundant "_sp" tips clean_pq(data_fungi_mini, tax_redundant_suffix = TRUE)
For the moment refseq slot need to be not Null.
compare_pairs_pq( physeq = NULL, bifactor = NULL, modality = NULL, merge_sample_by = NULL, nb_min_seq = 0, veg_index = "shannon", na_remove = TRUE, ... )compare_pairs_pq( physeq = NULL, bifactor = NULL, modality = NULL, merge_sample_by = NULL, nb_min_seq = 0, veg_index = "shannon", na_remove = TRUE, ... )
physeq |
(required) a |
bifactor |
(required) a factor (present in the |
modality |
the name of the column in the |
merge_sample_by |
a vector to determine
which samples to merge using the
|
nb_min_seq |
minimum number of sequences per sample to count the ASV/OTU |
veg_index |
(default: |
na_remove |
(logical, default TRUE) If set to TRUE, remove samples with NA in the variables set in bifactor, modality and merge_sample_by. NA in variables are well managed even if na_remove = FALSE, so na_remove may be useless. |
... |
Additional arguments passed to |
A tibble with information about the number of shared ASV, shared number of sequences and diversity
data_fungi_mini_lh <- subset_samples(data_fungi_mini, Height %in% c("Low", "High")) compare_pairs_pq(data_fungi_mini_lh, bifactor = "Height", merge_sample_by = "Height") compare_pairs_pq(data_fungi_mini_lh, bifactor = "Height", merge_sample_by = "Height", modality = "Time" )data_fungi_mini_lh <- subset_samples(data_fungi_mini, Height %in% c("Low", "High")) compare_pairs_pq(data_fungi_mini_lh, bifactor = "Height", merge_sample_by = "Height") compare_pairs_pq(data_fungi_mini_lh, bifactor = "Height", merge_sample_by = "Height", modality = "Time" )
Use grep to count the number of line with only one '+' (fastq, fastq.gz) or lines starting with a '>' (fasta) to count sequences.
count_seq(file_path = NULL, folder_path = NULL, pattern = NULL)count_seq(file_path = NULL, folder_path = NULL, pattern = NULL)
file_path |
The path to a fasta, fastq or fastq.gz file |
folder_path |
The path to a folder with fasta, fastq or fastq.gz files |
pattern |
A pattern to filter files in a folder. E.g. R2 |
the number of sequences
Adrien Taudière
count_seq(file_path = system.file( "extdata", "ex.fasta", package = "MiscMetabar", mustWork = TRUE )) count_seq( folder_path = system.file("extdata", package = "MiscMetabar"), pattern = "*.fasta" )count_seq(file_path = system.file( "extdata", "ex.fasta", package = "MiscMetabar", mustWork = TRUE )) count_seq( folder_path = system.file("extdata", package = "MiscMetabar"), pattern = "*.fasta" )
Wrapper around metagenomeSeq::cumNorm() / metagenomeSeq::MRcounts()
implementing Cumulative Sum Scaling (Paulson et al. 2013,
doi:10.1038/nmeth.2658).
css_pq(physeq, log = TRUE)css_pq(physeq, log = TRUE)
physeq |
(required) a |
log |
(logical, default |
A new phyloseq-class object with a CSS
normalised otu_table.
Adrien Taudière
metagenomeSeq::cumNorm()
data_f_css <- css_pq(data_fungi_mini)data_f_css <- css_pq(data_fungi_mini)
You need to install Cutadapt. See also https://github.com/VascoElbrecht/JAMP/blob/master/JAMP/R/Cutadapt.R for another call to cutadapt from R
cutadapt_remove_primers( path_to_fastq, primer_fw = NULL, primer_rev = NULL, folder_output = "wo_primers", nproc = 1, pattern = "fastq.gz", pattern_R1 = "_R1", pattern_R2 = "_R2", nb_files = Inf, cmd_is_run = TRUE, return_file_path = FALSE, cutadapt_args = "", args_before_cutadapt = "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv && ", verbose = TRUE )cutadapt_remove_primers( path_to_fastq, primer_fw = NULL, primer_rev = NULL, folder_output = "wo_primers", nproc = 1, pattern = "fastq.gz", pattern_R1 = "_R1", pattern_R2 = "_R2", nb_files = Inf, cmd_is_run = TRUE, return_file_path = FALSE, cutadapt_args = "", args_before_cutadapt = "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv && ", verbose = TRUE )
path_to_fastq |
(Required) A path to a folder with fastq files. See
|
primer_fw |
(Required, String) The forward primer DNA sequence. |
primer_rev |
(String) The reverse primer DNA sequence. |
folder_output |
The path to a folder for output files |
nproc |
(default 1) Set to number of cpus/processors to use for the clustering |
pattern |
a pattern to filter files (passed on to list.files function). |
pattern_R1 |
a pattern to filter R1 files (default "R1") |
pattern_R2 |
a pattern to filter R2 files (default "R2") |
nb_files |
the number of fastq files to list (default FALSE) |
cmd_is_run |
(logical, default TRUE) Do the cutadapt command is run. If set to FALSE, the only effect of the function is to return a list of command to manually run in a terminal. |
return_file_path |
(logical, default FALSE) If true, the function
return the path of the output folder (param |
cutadapt_args |
(default: "") A character string of additional arguments
passed directly to cutadapt. For example, use |
args_before_cutadapt |
(String) A one line bash command to run before to run cutadapt. For examples, "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv &&" allow to bypass the conda init which asks to restart the shell |
verbose |
(logical, default TRUE) If FALSE, suppresses all output from
the cutadapt command (stdout and stderr) as well as the completion message.
Note: standard R suppression functions ( |
This function is mainly a wrapper of the work of others. Please cite cutadapt (doi:10.14806/ej.17.1.200).
a list of command or if return_file_path is TRUE, the path to
the output folder
Adrien Taudière
## Not run: cutadapt_remove_primers(system.file("extdata", package = "MiscMetabar"), "TTC", "GAA", folder_output = tempdir() ) cutadapt_remove_primers( system.file("extdata", package = "dada2" ), pattern_R1 = "F.fastq.gz", pattern_R2 = "R.fastq.gz", primer_fw = "TTC", primer_rev = "GAA", folder_output = tempdir() ) cutadapt_remove_primers( system.file("extdata", package = "dada2" ), pattern_R1 = "F.fastq.gz", primer_fw = "TTC", folder_output = tempdir(), cmd_is_run = FALSE ) # Use a stricter error rate (1%) instead of the cutadapt default (10%) cutadapt_remove_primers( system.file("extdata", package = "MiscMetabar"), "TTC", "GAA", folder_output = tempdir(), cutadapt_args = "-e 0.01", cmd_is_run = FALSE ) unlink(tempdir(), recursive = TRUE) ## End(Not run)## Not run: cutadapt_remove_primers(system.file("extdata", package = "MiscMetabar"), "TTC", "GAA", folder_output = tempdir() ) cutadapt_remove_primers( system.file("extdata", package = "dada2" ), pattern_R1 = "F.fastq.gz", pattern_R2 = "R.fastq.gz", primer_fw = "TTC", primer_rev = "GAA", folder_output = tempdir() ) cutadapt_remove_primers( system.file("extdata", package = "dada2" ), pattern_R1 = "F.fastq.gz", primer_fw = "TTC", folder_output = tempdir(), cmd_is_run = FALSE ) # Use a stricter error rate (1%) instead of the cutadapt default (10%) cutadapt_remove_primers( system.file("extdata", package = "MiscMetabar"), "TTC", "GAA", folder_output = tempdir(), cutadapt_args = "-e 0.01", cmd_is_run = FALSE ) unlink(tempdir(), recursive = TRUE) ## End(Not run)
Fungal OTU in phyloseq format
data(data_fungi)data(data_fungi)
A physeq object containing 1420 taxa with references sequences described by 14 taxonomic ranks and 185 samples described by 7 sample variables:
X: the name of the fastq-file
Sample_names: the names of ... the samples
Treename: the name of an tree
Sample_id: identifier for each sample
Height: height of the sample in the tree
Diameter: diameter of the trunk
Time: time since the dead of the tree
It is a subset of the data_fungi dataset including only Basidiomycota with more than 5000 sequences.
data(data_fungi_mini) data(data_fungi_mini)data(data_fungi_mini) data(data_fungi_mini)
A physeq object containing 45 taxa with references sequences described by 14 taxonomic ranks and 137 samples described by 7 sample variables:
X: the name of the fastq-file
Sample_names: the names of ... the samples
Treename: the name of an tree
Sample_id: identifier for each sample
Height: height of the sample in the tree
Diameter: diameter of the trunk
Time: time since the dead of the tree
A physeq object containing 45 taxa with references sequences described by 14 taxonomic ranks and 137 samples described by 7 sample variables:
X: the name of the fastq-file
Sample_names: the names of ... the samples
Treename: the name of an tree
Sample_id: identifier for each sample
Height: height of the sample in the tree
Diameter: diameter of the trunk
Time: time since the dead of the tree
Obtain using data_fungi_mini <- subset_taxa(data_fungi, Phylum == "Basidiomycota")
and then data_fungi_mini <- subset_taxa_pq(data_fungi_mini, colSums(data_fungi_mini@otu_table) > 5000)
It is a subset of the data_fungi dataset including only taxa with information at the species level
data(data_fungi_sp_known)data(data_fungi_sp_known)
A physeq object containing 651 taxa with references sequences described by 14 taxonomic ranks and 185 samples described by 7 sample variables:
X: the name of the fastq-file
Sample_names: the names of ... the samples
Treename: the name of an tree
Sample_id: identifier for each sample
Height: height of the sample in the tree
Diameter: diameter of the trunk
Time: time since the dead of the tree
Obtain using data_fungi_sp_known <- subset_taxa(data_fungi, !is.na(data_fungi@tax_table[,"Species"]))
Mainly an internal function useful in "sapply(..., tapply)" methods
diff_fct_diff_class( x, numeric_fonction = mean, logical_method = "TRUE_if_one", character_method = "unique_or_na", ... )diff_fct_diff_class( x, numeric_fonction = mean, logical_method = "TRUE_if_one", character_method = "unique_or_na", ... )
x |
: a vector |
numeric_fonction |
: a function for numeric vector. For ex. |
logical_method |
: A method for logical vector. One of :
|
character_method |
: A method for character vector (and factor). One of :
|
... |
Additional arguments passed on to the numeric function (ex. na.rm=TRUE) |
a single value
Adrien Taudière
diff_fct_diff_class( data_fungi@sam_data$Sample_id, numeric_fonction = sum, na.rm = TRUE ) diff_fct_diff_class( data_fungi@sam_data$Time, numeric_fonction = mean, na.rm = TRUE ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "TRUE_if_one" ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "NA_if_not_all_TRUE" ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "FALSE_if_not_all_TRUE" ) diff_fct_diff_class( data_fungi@sam_data$Height, character_method = "unique_or_na" ) diff_fct_diff_class( c("IE", "IE"), character_method = "unique_or_na" ) diff_fct_diff_class( c("IE", "IE", "TE", "TE"), character_method = "more_frequent" ) diff_fct_diff_class( c("IE", "IE", "TE", "TE"), character_method = "more_frequent_without_equality" )diff_fct_diff_class( data_fungi@sam_data$Sample_id, numeric_fonction = sum, na.rm = TRUE ) diff_fct_diff_class( data_fungi@sam_data$Time, numeric_fonction = mean, na.rm = TRUE ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "TRUE_if_one" ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "NA_if_not_all_TRUE" ) diff_fct_diff_class( data_fungi@sam_data$Height == "Low", logical_method = "FALSE_if_not_all_TRUE" ) diff_fct_diff_class( data_fungi@sam_data$Height, character_method = "unique_or_na" ) diff_fct_diff_class( c("IE", "IE"), character_method = "unique_or_na" ) diff_fct_diff_class( c("IE", "IE", "TE", "TE"), character_method = "more_frequent" ) diff_fct_diff_class( c("IE", "IE", "TE", "TE"), character_method = "more_frequent_without_equality" )
May be used to verify ecological distance among samples.
dist_bycol(x, y, method = "bray", nperm = 99, ...)dist_bycol(x, y, method = "bray", nperm = 99, ...)
x |
(required) A first matrix. |
y |
(required) A second matrix. |
method |
(default: 'bray') the method to use internally in the vegdist function. |
nperm |
(int) The number of permutations to perform. |
... |
Additional arguments passed on to |
A list of length two : (i) a vector of observed distance ($obs) and (ii) a matrix of the distance after randomization ($null)
the first column of the first matrix is compare to the first column of the second matrix, the second column of the first matrix is compare to the second column of the second matrix and so on.
Adrien Taudière
m1 <- matrix(runif(9), nrow = 3) m2 <- matrix(runif(9), nrow = 3) dist_bycol(m1, m2, nperm = 9)m1 <- matrix(runif(9), nrow = 3) m2 <- matrix(runif(9), nrow = 3) dist_bycol(m1, m2, nperm = 9)
Compute distance among positive controls, i.e. samples which are duplicated to test for variation, for example in (i) a step in the sampling, (ii) a step in the extraction, (iii) a step in the sequencing.
dist_pos_control(physeq, samples_names, method = "bray")dist_pos_control(physeq, samples_names, method = "bray")
physeq |
(required) a |
samples_names |
(required) a vector of names for samples with positives controls of the same samples having the same name |
method |
(default: "bray") a method to calculate
the distance, parsed to |
A list of two data-frames with (i) the distance among positive controls and (ii) the distance among all samples
Adrien Taudière
data("enterotype") sam_name_factice <- gsub("TS1_V2", "TS10_V2", sample_names(enterotype)) res_dist_cont <- dist_pos_control(enterotype, sam_name_factice) hist(unlist(res_dist_cont$distAllSamples)) abline( v = mean(unlist(res_dist_cont$dist_controlontrolSamples), na.rm = TRUE), col = "red", lwd = 3 )data("enterotype") sam_name_factice <- gsub("TS1_V2", "TS10_V2", sample_names(enterotype)) res_dist_cont <- dist_pos_control(enterotype, sam_name_factice) hist(unlist(res_dist_cont$distAllSamples)) abline( v = mean(unlist(res_dist_cont$dist_controlontrolSamples), na.rm = TRUE), col = "red", lwd = 3 )
Focus on one taxon and one factor.
distri_1_taxa(physeq, fact, taxa_name, digits = 2)distri_1_taxa(physeq, fact, taxa_name, digits = 2)
physeq |
(required) a |
fact |
(required) Name of the factor in |
taxa_name |
(required) the name of the taxa |
digits |
(default = 2) integer indicating the number of decimal places
to be used (see |
a dataframe with levels as rows and information as column :
the number of sequences of the taxa (nb_seq)
the number of samples of the taxa (nb_samp)
the mean (mean_nb_seq) and standard deviation (sd_nb_seq) of the nb_seq
the mean (mean_nb_seq_when_present) nb_seq excluding samples with zero
the total number of samples (nb_total_samp)
the proportion of samples with the taxa
Adrien Taudière
distri_1_taxa(data_fungi_mini, "Height", "ASV7") distri_1_taxa(data_fungi, "Time", "ASV81", digits = 1)distri_1_taxa(data_fungi_mini, "Height", "ASV7") distri_1_taxa(data_fungi, "Time", "ASV81", digits = 1)
Iterates over all samples in an OTU table and computes Hill diversity
numbers using divent::div_hill().
divent_hill_matrix_pq(comm, q, ...)divent_hill_matrix_pq(comm, q, ...)
comm |
(data.frame or matrix) OTU table with samples as rows and taxa as columns. |
q |
(numeric vector) Hill diversity orders to compute. Hill numbers are
more appropriate in DNA metabarcoding studies when |
... |
Additional arguments passed to |
A data.frame with one row per sample and one column per value in
q. Column names are the string representation of the q values.
Row names match the input row names.
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
divent::div_hill(), hill_pq(), hill_tuckey_pq()
data("data_fungi_mini", package = "MiscMetabar") data_f <- prune_samples( sample_names(data_fungi_mini)[1:5], data_fungi_mini ) otu <- as.data.frame(phyloseq::otu_table( taxa_as_columns(data_f) )) divent_hill_matrix_pq(otu, q = c(0, 1, 2))data("data_fungi_mini", package = "MiscMetabar") data_f <- prune_samples( sample_names(data_fungi_mini)[1:5], data_fungi_mini ) otu <- as.data.frame(phyloseq::otu_table( taxa_as_columns(data_f) )) divent_hill_matrix_pq(otu, q = c(0, 1, 2))
Translates a factor into colors.
fac2col(x, col.pal = funky_color, na.col = "grey", seed = NULL)fac2col(x, col.pal = funky_color, na.col = "grey", seed = NULL)
x |
a numeric vector (for num2col) or a vector converted to a factor (for fac2col). |
col.pal |
(default funky_color) a function generating colors according to a given palette. |
na.col |
(default grey) the color to be used for missing values (NAs) |
seed |
(default NULL) a seed for R's random number generated, used to fix the random permutation of colors in the palette used; if NULL, no randomization is used and the colors are taken from the palette according to the ordering of the levels |
a color vector
Thibaut Jombart in adegenet package
The R package RColorBrewer, proposing a nice selection of color palettes. The viridis package, with many excellent palettes
fac2col(c("a", "b", "a", "c"))fac2col(c("a", "b", "a", "c"))
Basically a wraper of subset_taxa_pq().
filt_taxa_pq( physeq, min_nb_seq = NULL, min_occurence = NULL, combination = "AND", clean_pq = TRUE )filt_taxa_pq( physeq, min_nb_seq = NULL, min_occurence = NULL, combination = "AND", clean_pq = TRUE )
physeq |
(required) a |
min_nb_seq |
(int default NULL) minimum number of sequences by taxa. |
min_occurence |
(int default NULL) minimum number of sample by taxa. |
combination |
Either "AND" (default) or "OR". If set to "AND" and both min_nb_seq and min_occurence are not NULL, the taxa must match the two condition to passe the filter. If set to "OR", taxa matching only one condition are kept. |
clean_pq |
(logical) If set to TRUE, empty samples and empty taxa (ASV, OTU) are discarded after filtering. |
a new phyloseq object
Adrien Taudière
filt_taxa_pq(data_fungi, min_nb_seq = 20) filt_taxa_pq(data_fungi, min_occurence = 2) filt_taxa_pq(data_fungi, min_occurence = 2, min_nb_seq = 10, clean_pq = FALSE ) filt_taxa_pq(data_fungi, min_occurence = 2, min_nb_seq = 10, combination = "OR" )filt_taxa_pq(data_fungi, min_nb_seq = 20) filt_taxa_pq(data_fungi, min_occurence = 2) filt_taxa_pq(data_fungi, min_occurence = 2, min_nb_seq = 10, clean_pq = FALSE ) filt_taxa_pq(data_fungi, min_occurence = 2, min_nb_seq = 10, combination = "OR" )
Basically a wrapper of subset_taxa_pq()
filt_taxa_wo_NA( physeq, taxa_ranks = NULL, n_NA = 0, verbose = TRUE, NA_equivalent = NULL, clean_pq = TRUE )filt_taxa_wo_NA( physeq, taxa_ranks = NULL, n_NA = 0, verbose = TRUE, NA_equivalent = NULL, clean_pq = TRUE )
physeq |
(required) a |
taxa_ranks |
A vector of taxonomic ranks. For examples c("Family","Genus"). If taxa_ranks is NULL (default), all ranks are used, i.e. all taxa with at least 1 NA will be filtered out. Numeric position of taxonomic ranks can also be used. |
n_NA |
(int default = 0). Number of allowed NA by taxa in the list of the taxonomic ranks |
verbose |
(logical). If TRUE, print additional information. |
NA_equivalent |
(vector of character, default NULL). Exact matching of the character listed in the vector are converted as NA before to filter out taxa. |
clean_pq |
(logical, default TRUE)
If set to TRUE, empty samples are discarded after filtering. See |
An object of class phyloseq
Adrien Taudière
data_fungi_wo_NA <- filt_taxa_wo_NA(data_fungi) filt_taxa_wo_NA(data_fungi, n_NA = 1) filt_taxa_wo_NA(data_fungi, taxa_ranks = c(1:3)) filt_taxa_wo_NA(data_fungi, taxa_ranks = c("Trait", "Confidence.Ranking")) filt_taxa_wo_NA(data_fungi, taxa_ranks = c("Trait", "Confidence.Ranking"), NA_equivalent = c("-", "NULL") )data_fungi_wo_NA <- filt_taxa_wo_NA(data_fungi) filt_taxa_wo_NA(data_fungi, n_NA = 1) filt_taxa_wo_NA(data_fungi, taxa_ranks = c(1:3)) filt_taxa_wo_NA(data_fungi, taxa_ranks = c("Trait", "Confidence.Ranking")) filt_taxa_wo_NA(data_fungi, taxa_ranks = c("Trait", "Confidence.Ranking"), NA_equivalent = c("-", "NULL") )
Use the blast software.
filter_asv_blast( physeq, fasta_for_db = NULL, database = NULL, clean_pq = TRUE, add_info_to_taxtable = TRUE, id_filter = 90, bit_score_filter = 50, min_cover_filter = 50, e_value_filter = 1e-30, ... ) filter_taxa_blast( physeq, fasta_for_db = NULL, database = NULL, clean_pq = TRUE, add_info_to_taxtable = TRUE, id_filter = 90, bit_score_filter = 50, min_cover_filter = 50, e_value_filter = 1e-30, ... )filter_asv_blast( physeq, fasta_for_db = NULL, database = NULL, clean_pq = TRUE, add_info_to_taxtable = TRUE, id_filter = 90, bit_score_filter = 50, min_cover_filter = 50, e_value_filter = 1e-30, ... ) filter_taxa_blast( physeq, fasta_for_db = NULL, database = NULL, clean_pq = TRUE, add_info_to_taxtable = TRUE, id_filter = 90, bit_score_filter = 50, min_cover_filter = 50, e_value_filter = 1e-30, ... )
physeq |
(required) a |
fasta_for_db |
path to a fasta file to make the blast database |
database |
path to a blast database |
clean_pq |
(logical) If set to TRUE, empty samples and empty taxa (ASV, OTU) are discarded after filtering. |
add_info_to_taxtable |
(logical, default TRUE) Does the blast information are added to the taxtable ? |
id_filter |
(default: 90) cut of in identity percent to keep result |
bit_score_filter |
(default: 50) cut of in bit score to keep result The higher the bit-score, the better the sequence similarity. The bit-score is the requires size of a sequence database in which the current match could be found just by chance. The bit-score is a log2 scaled and normalized raw-score. Each increase by one doubles the required database size (2bit-score). |
min_cover_filter |
(default: 50) cut of in query cover (%) to keep result |
e_value_filter |
(default: 1e-30) cut of in e-value (%) to keep result The BLAST E-value is the number of expected hits of similar quality (score) that could be found just by chance. |
... |
Additional arguments passed on to |
A new phyloseq-class object, or NULL if no
taxa matched the blast database or if no taxa passed the filter criteria.
In either case, an informative message is printed.
## Not run: filter_asv_blast(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)## Not run: filter_asv_blast(data_fungi_mini, fasta_for_db = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) ) ## End(Not run)
dada2::filterAndTrim() to use in
targets pipelineThis function filter and trim (with parameters passed on to
dada2::filterAndTrim() function) forward sequences or paired end
sequence if 'rev' parameter is set. It return the list of files to
subsequent analysis in a targets pipeline.
filter_trim( fw = NULL, rev = NULL, output_fw = file.path(paste(getwd(), "/output/filterAndTrim_fwd", sep = "")), output_rev = file.path(paste(getwd(), "/output/filterAndTrim_rev", sep = "")), return_a_vector = FALSE, ... )filter_trim( fw = NULL, rev = NULL, output_fw = file.path(paste(getwd(), "/output/filterAndTrim_fwd", sep = "")), output_rev = file.path(paste(getwd(), "/output/filterAndTrim_rev", sep = "")), return_a_vector = FALSE, ... )
fw |
(required) a list of forward fastq files |
rev |
a list of reverse fastq files for paired end trimming |
output_fw |
Path to output folder for forward files. By default, this function will create a folder "output/filterAndTrim_fwd" in the current working directory. |
output_rev |
Path to output folder for reverse files. By default, this function will create a folder "output/filterAndTrim_fwd" in the current working directory. |
return_a_vector |
(logical, default FALSE) If true, the return is a vector of path (usefull when used with targets::tar_targets(..., format="file")) |
... |
Other parameters passed on to |
A list of files. If rev is set, will return a list of two lists. The first list is a list of forward files, and the second one is a list of reverse files.
Adrien Taudière
testFastqs_fw <- c( system.file("extdata", "sam1F.fastq.gz", package = "dada2"), system.file("extdata", "sam2F.fastq.gz", package = "dada2") ) testFastqs_rev <- c( system.file("extdata", "sam1R.fastq.gz", package = "dada2"), system.file("extdata", "sam2R.fastq.gz", package = "dada2") ) filt_fastq_fw <- filter_trim(testFastqs_fw, output_fw = tempdir()) derep_fw <- dada2::derepFastq(filt_fastq_fw[1]) derep_fw ## Not run: filt_fastq_pe <- filter_trim(testFastqs_fw, testFastqs_rev, output_fw = paste0(tempdir(), "/", "fw"), output_rev = paste0(tempdir(), "rev") ) derep_fw_pe <- dada2::derepFastq(filt_fastq_pe[[1]]) derep_rv_pe <- dada2::derepFastq(filt_fastq_pe[[2]]) derep_fw_pe derep_rv_pe ## End(Not run)testFastqs_fw <- c( system.file("extdata", "sam1F.fastq.gz", package = "dada2"), system.file("extdata", "sam2F.fastq.gz", package = "dada2") ) testFastqs_rev <- c( system.file("extdata", "sam1R.fastq.gz", package = "dada2"), system.file("extdata", "sam2R.fastq.gz", package = "dada2") ) filt_fastq_fw <- filter_trim(testFastqs_fw, output_fw = tempdir()) derep_fw <- dada2::derepFastq(filt_fastq_fw[1]) derep_fw ## Not run: filt_fastq_pe <- filter_trim(testFastqs_fw, testFastqs_rev, output_fw = paste0(tempdir(), "/", "fw"), output_rev = paste0(tempdir(), "rev") ) derep_fw_pe <- dada2::derepFastq(filt_fastq_pe[[1]]) derep_rv_pe <- dada2::derepFastq(filt_fastq_pe[[2]]) derep_fw_pe derep_rv_pe ## End(Not run)
Looks for the MMseqs2 binary in three places, in order:
The option MiscMetabar.mmseqs2path (if set).
A local copy installed by install_mmseqs2() in the user data directory.
The system PATH.
find_mmseqs2()find_mmseqs2()
A character string with the path to the mmseqs binary.
Adrien Taudière
install_mmseqs2(), is_mmseqs2_installed(), assign_mmseqs2()
Searches for the vsearch binary in the following order:
The MiscMetabar.vsearchpath option (if set)
A previously installed copy in the MiscMetabar user data directory
(via install_vsearch())
The system PATH
find_vsearch()find_vsearch()
A character string with the path to the vsearch binary, or
"vsearch" as a fallback (relying on PATH resolution).
Adrien Taudière
install_vsearch(), is_vsearch_installed()
find_vsearch()find_vsearch()
First format in sintax format and then in dada2 format
format2dada2( fasta_db = NULL, taxnames = NULL, output_path = NULL, from_sintax = TRUE, pattern_to_remove = NULL, ... )format2dada2( fasta_db = NULL, taxnames = NULL, output_path = NULL, from_sintax = TRUE, pattern_to_remove = NULL, ... )
fasta_db |
A link to a fasta files |
taxnames |
A list of names to format. You must specify either fasta_db OR taxnames, not both. |
output_path |
(optional) A path to an output fasta files. Only used if fasta_db is set. |
from_sintax |
(logical, default FALSE) Is the original fasta file in sintax format? |
pattern_to_remove |
(a regular expression) Define a pattern to remove. For example,
pattern_to_remove = "\|rep.*" remove all character after '|rep' to force |
... |
Additional arguments passed on to |
Either an object of class DNAStringSet or a vector of reformated names
Adrien Taudière
format2dada2_species(), format2sintax()
## Not run: f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2dada2(fasta_db = f, from_sintax = FALSE) ## End(Not run)## Not run: f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2dada2(fasta_db = f, from_sintax = FALSE) ## End(Not run)
First format in sintax format and then in dada2 format
format2dada2_species( fasta_db = NULL, taxnames = NULL, from_sintax = FALSE, output_path = NULL, ... )format2dada2_species( fasta_db = NULL, taxnames = NULL, from_sintax = FALSE, output_path = NULL, ... )
fasta_db |
A link to a fasta files |
taxnames |
A list of names to format. You must specify either fasta_db OR taxnames, not both. |
from_sintax |
(logical, default FALSE) Is the original fasta file in sintax format? |
output_path |
(optional) A path to an output fasta files. Only used if fasta_db is set. |
... |
Additional arguments passed on to |
Either an object of class DNAStringSet or a vector of reformated names
Adrien Taudière
format2dada2_species(), format2sintax()
f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2dada2_species(fasta_db = f)f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2dada2_species(fasta_db = f)
Only tested with Unite and Eukaryome fasta file for the moment. Rely on the presence of the pattern pattern_tax default "k__" to format the header.
A reference database in sintax format contain taxonomic information in the header of each sequence in the form of a string starting with ";tax=" and followed by a comma-separated list of up to nine taxonomic identifiers. Each taxonomic identifier must start with an indication of the rank by one of the letters d (for domain) k (kingdom), p (phylum), c (class), o (order), f (family), g (genus), s (species), or t (strain). The letter is followed by a colon (:) and the name of that rank. Commas and semicolons are not allowed in the name of the rank. Non-ascii characters should be avoided in the names.
Example:
\>X80725_S000004313;tax=d:Bacteria,p:Proteobacteria,c:Gammaproteobacteria,o:Enterobacteriales,f:Enterobacteriaceae,g:Escherichia/Shigella,s:Escherichia_coli,t:str._K-12_substr._MG1655
format2sintax( fasta_db = NULL, taxnames = NULL, pattern_tax = "k__", pattern_sintax = "tax=k:", output_path = NULL )format2sintax( fasta_db = NULL, taxnames = NULL, pattern_tax = "k__", pattern_sintax = "tax=k:", output_path = NULL )
fasta_db |
A link to a fasta files |
taxnames |
A list of names to format. You must specify either fasta_db OR taxnames, not both. |
pattern_tax |
(default "k__") The pattern to replace by pattern_sintax. |
pattern_sintax |
(default "tax=k:") Useless for most users. Sometimes you may want to replacte by "tax=d:" (d for domain instead of kingdom). |
output_path |
(optional) A path to an output fasta files. Only used if fasta_db is set. |
Either an object of class DNAStringSet or a vector of reformated names
Adrien Taudière
format2dada2_species(), format2dada2()
f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2sintax(fasta_db = f)f <- system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" ) format2sintax(fasta_db = f)
Allow to visualize a table with graphical input.
formattable_pq( physeq, modality, taxonomic_levels = c("Phylum", "Order", "Family", "Genus"), min_nb_seq_taxa = 1000, log10trans = FALSE, void_style = FALSE, lev_col_taxa = "Phylum", arrange_by = "nb_seq", descending_order = TRUE, na_remove = TRUE, formattable_args = NULL )formattable_pq( physeq, modality, taxonomic_levels = c("Phylum", "Order", "Family", "Genus"), min_nb_seq_taxa = 1000, log10trans = FALSE, void_style = FALSE, lev_col_taxa = "Phylum", arrange_by = "nb_seq", descending_order = TRUE, na_remove = TRUE, formattable_args = NULL )
physeq |
(required) a |
modality |
(required) The name of a column present in the |
taxonomic_levels |
(default = c("Phylum", "Order", "Family", "Genus"))
The taxonomic levels (must be present in the |
min_nb_seq_taxa |
(default = 1000) filter out taxa with less than |
log10trans |
(logical, default TRUE) Do sequences count is log10 transformed (using log10(x + 1) to allow 0) |
void_style |
(logical, default FALSE) Do the default style is discard ? |
lev_col_taxa |
Taxonomic level used to plot the background color of taxa names |
arrange_by |
The column used to sort the table. Can take the values NULL, "proportion_samp", "nb_seq" (default), , "nb_sam" "OTU", or a column names from the levels of modality or from taxonomic levels |
descending_order |
(logical, default TRUE) Do we use descending order when sort the table (if arrange_by is not NULL) ? |
na_remove |
(logical, default TRUE) if TRUE remove all the samples
with NA in the |
formattable_args |
Other args to the formattable function. See examples and |
This function is mainly a wrapper of the work of others.
Please make a reference to formattable::formattable() if you
use this function.
A datatable
Adrien Taudière
formattable::formattable()
if (requireNamespace("formattable")) { ## Distribution of the nb of sequences per OTU across Height ## modality (nb of sequences are log-transformed). ## Only OTU with more than 10000 sequences are taking into account ## The Phylum column is discarded formattable_pq( data_fungi, "Height", min_nb_seq_taxa = 10000, formattable_args = list("Phylum" = FALSE), log10trans = TRUE ) ## Distribution of the nb of samples per OTU across Height modality ## Only OTU present in more than 50 samples are taking into account formattable_pq( as_binary_otu_table(data_fungi), "Height", min_nb_seq_taxa = 50, formattable_args = list("nb_seq" = FALSE), ) ## Distribution of the nb of sequences per OTU across Time modality ## arranged by Family Name in ascending order. ## Only OTU with more than 10000 sequences are taking into account ## The Phylum column is discarded formattable_pq( data_fungi, "Time", min_nb_seq_taxa = 10000, taxonomic_levels = c("Order", "Family", "Genus", "Species"), formattable_args = list( Order = FALSE, Species = formattable::formatter( "span", style = x ~ formattable::style( "font-style" = "italic", `color` = ifelse(is.na(x), "white", "grey") ) ) ), arrange_by = "Family", descending_order = FALSE ) } if (requireNamespace("formattable")) { ## Distribution of the nb of sequences per OTU across Height modality ## (nb of sequences are log-transformed). ## OTU name background is light gray for Basidiomycota ## and dark grey otherwise (Ascomycota) ## A different color is defined for each modality level formattable_pq( data_fungi, "Height", taxonomic_levels = c("Phylum", "Family", "Genus"), void_style = TRUE, formattable_args = list( OTU = formattable::formatter( "span", style = ~ formattable::style( "display" = "block", `border-radius` = "5px", `background-color` = ifelse(Phylum == "Basidiomycota", transp("gray"), "gray") ), `padding-right` = "2px" ), High = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("#1a91ff"), "#1a91ff" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ), Low = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("green"), "green" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ), Middle = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("orange"), "orange" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ) ) ) }if (requireNamespace("formattable")) { ## Distribution of the nb of sequences per OTU across Height ## modality (nb of sequences are log-transformed). ## Only OTU with more than 10000 sequences are taking into account ## The Phylum column is discarded formattable_pq( data_fungi, "Height", min_nb_seq_taxa = 10000, formattable_args = list("Phylum" = FALSE), log10trans = TRUE ) ## Distribution of the nb of samples per OTU across Height modality ## Only OTU present in more than 50 samples are taking into account formattable_pq( as_binary_otu_table(data_fungi), "Height", min_nb_seq_taxa = 50, formattable_args = list("nb_seq" = FALSE), ) ## Distribution of the nb of sequences per OTU across Time modality ## arranged by Family Name in ascending order. ## Only OTU with more than 10000 sequences are taking into account ## The Phylum column is discarded formattable_pq( data_fungi, "Time", min_nb_seq_taxa = 10000, taxonomic_levels = c("Order", "Family", "Genus", "Species"), formattable_args = list( Order = FALSE, Species = formattable::formatter( "span", style = x ~ formattable::style( "font-style" = "italic", `color` = ifelse(is.na(x), "white", "grey") ) ) ), arrange_by = "Family", descending_order = FALSE ) } if (requireNamespace("formattable")) { ## Distribution of the nb of sequences per OTU across Height modality ## (nb of sequences are log-transformed). ## OTU name background is light gray for Basidiomycota ## and dark grey otherwise (Ascomycota) ## A different color is defined for each modality level formattable_pq( data_fungi, "Height", taxonomic_levels = c("Phylum", "Family", "Genus"), void_style = TRUE, formattable_args = list( OTU = formattable::formatter( "span", style = ~ formattable::style( "display" = "block", `border-radius` = "5px", `background-color` = ifelse(Phylum == "Basidiomycota", transp("gray"), "gray") ), `padding-right` = "2px" ), High = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("#1a91ff"), "#1a91ff" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ), Low = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("green"), "green" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ), Middle = formattable::formatter( "span", style = x ~ formattable::style( "font-size" = "80%", "display" = "inline-block", direction = "rtl", `border-radius` = "0px", `padding-right` = "2px", `background-color` = formattable::csscolor(formattable::gradient( as.numeric(x), transp("orange"), "orange" )), width = formattable::percent(formattable::proportion(as.numeric(x), na.rm = TRUE)) ) ) ) ) }
The original function and documentation was written by Brendan Furneaux in the FUNGuildR package.
These functions have identical behavior if supplied with a database; however they download the database corresponding to their name by default.
Taxa present in the database are matched to the taxa present in the supplied
otu_table by exact name.
In the case of multiple matches, the lowest (most specific) rank is chosen.
No attempt is made to check or correct the classification in
otu_table$Taxonomy.
funguild_assign( otu_table, db_url = NULL, db_funguild = NULL, tax_col = "Taxonomy" )funguild_assign( otu_table, db_url = NULL, db_funguild = NULL, tax_col = "Taxonomy" )
otu_table |
A |
db_url |
a length 1 character string giving the URL to retrieve the database from |
db_funguild |
A |
tax_col |
A |
A tibble::tibble containing all columns of
otu_table, plus relevant columns of information from the FUNGuild
Brendan Furneaux (orcid: 0000-0003-3522-7363), modified by Adrien Taudière
Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG. 2016. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecology 20:241-248.
## Not run: db <- get_funguild_db() data_fungi_FUNGUILD <- funguild_assign(as.data.frame(tax_table(data_fungi)), db_funguild = db, tax_col = "Genus_species" ) ncol(data_fungi_FUNGUILD) ## End(Not run)## Not run: db <- get_funguild_db() data_fungi_FUNGUILD <- funguild_assign(as.data.frame(tax_table(data_fungi)), db_funguild = db, tax_col = "Genus_species" ) ncol(data_fungi_FUNGUILD) ## End(Not run)
Funky palette color
funky_color(n)funky_color(n)
n |
a number of colors |
a color palette
Thibaut Jombart in adegenet package
The R package RColorBrewer, proposing a nice selection of color palettes. The viridis package, with many excellent palettes
funky_color(5)funky_color(5)
Internally used in count_seq().
Warning: don't work when there is '.' in the name of the
file before the extension
get_file_extension(file_path)get_file_extension(file_path)
file_path |
(required) path to a file |
The extension of a file.
Adrien Taudière
get_file_extension("myfile.fasta")get_file_extension("myfile.fasta")
The original function and documentation was written by Brendan Furneaux in the FUNGuildR package.
Please cite this publication (doi:10.1016/j.funeco.2015.06.006).
get_funguild_db(db_url = "http://www.stbates.org/funguild_db_2.php")get_funguild_db(db_url = "http://www.stbates.org/funguild_db_2.php")
db_url |
a length 1 character string giving the URL to retrieve the database from |
a tibble::tibble containing the database, which can be passed
to the db argument of funguild_assign()
Brendan Furneaux (orcid: 0000-0003-3522-7363), modified by Adrien Taudière
Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG. 2016. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecology 20:241-248.
## Not run: get_funguild_db() ## End(Not run)## Not run: get_funguild_db() ## End(Not run)
Basically a wrapper of ggalluvial package
ggaluv_pq( physeq, taxa_ranks = c("Phylum", "Class", "Order", "Family"), wrap_factor = NULL, by_sample = FALSE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, fact = NULL, type = "nb_seq", width = 1.2, min.size = 3, na_remove = FALSE, use_ggfittext = FALSE, use_geom_label = FALSE, size_lab = 2, ... )ggaluv_pq( physeq, taxa_ranks = c("Phylum", "Class", "Order", "Family"), wrap_factor = NULL, by_sample = FALSE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, fact = NULL, type = "nb_seq", width = 1.2, min.size = 3, na_remove = FALSE, use_ggfittext = FALSE, use_geom_label = FALSE, size_lab = 2, ... )
physeq |
(required) a |
taxa_ranks |
A vector of taxonomic ranks. For examples c("Family","Genus"). If taxa ranks is not set (default value = c("Phylum", "Class", "Order", "Family")). |
wrap_factor |
A name to determine
which samples to merge using |
by_sample |
(logical) If FALSE (default), sample information is not taking into account, so the taxonomy is studied globally. If fact is not NULL, by_sample is automatically set to TRUE. |
rarefy_by_sample |
(logical, default FALSE) If TRUE, rarefy
samples using |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
fact |
(required) Name of the factor in |
type |
If "nb_seq" (default), the number of sequences is used in plot. If "nb_taxa", the number of ASV is plotted. |
width |
(passed on to |
min.size |
(passed on to |
na_remove |
(logical, default FALSE) If set to TRUE, remove samples with NA in the variables set in formula. |
use_ggfittext |
(logical, default FALSE) Do we use ggfittext to plot labels? |
use_geom_label |
(logical, default FALSE) Do we use geom_label to plot labels? |
size_lab |
Size for label if use_ggfittext is FALSE |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to ggalluvial package if you
use this function.
When you want to add text to the plot, this function requires
ggalluvial to be loaded with before use (library(ggalluvial)).
A ggplot object
Adrien Taudière
if (requireNamespace("ggalluvial")) { ggaluv_pq(data_fungi_mini) } if (requireNamespace("ggalluvial")) { library(ggalluvial) ggaluv_pq(data_fungi_mini) ggaluv_pq(data_fungi_mini, type = "nb_taxa") + geom_text(stat = "stratum", size = 1.8) ggaluv_pq(data_fungi_mini, wrap_factor = "Height", by_sample = TRUE, type = "nb_taxa" ) + facet_wrap("Height") ggaluv_pq(data_fungi_mini, width = 0.9, min.size = 10, type = "nb_taxa", taxa_ranks = c("Phylum", "Class", "Order", "Family", "Genus") ) + coord_flip() + scale_x_discrete(limits = rev) }if (requireNamespace("ggalluvial")) { ggaluv_pq(data_fungi_mini) } if (requireNamespace("ggalluvial")) { library(ggalluvial) ggaluv_pq(data_fungi_mini) ggaluv_pq(data_fungi_mini, type = "nb_taxa") + geom_text(stat = "stratum", size = 1.8) ggaluv_pq(data_fungi_mini, wrap_factor = "Height", by_sample = TRUE, type = "nb_taxa" ) + facet_wrap("Height") ggaluv_pq(data_fungi_mini, width = 0.9, min.size = 10, type = "nb_taxa", taxa_ranks = c("Phylum", "Class", "Order", "Family", "Genus") ) + coord_flip() + scale_x_discrete(limits = rev) }
Note that contrary to hill_pq(), this function does not take into
account for difference in the number of sequences per samples/modalities.
You may use rarefy_by_sample = TRUE if the mean number of sequences per
samples differs among modalities.
Basically a wrapper of function ggstatsplot::ggbetweenstats() for
object of class phyloseq
ggbetween_pq( physeq, fact, one_plot = FALSE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, q = c(0, 1, 2), ... )ggbetween_pq( physeq, fact, one_plot = FALSE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, q = c(0, 1, 2), ... )
physeq |
(required) a |
fact |
(required) The variable to test. Must be present in
the |
one_plot |
(logical, default FALSE) If TRUE, return a unique plot with the three plot inside using the patchwork package. |
rarefy_by_sample |
(logical, default FALSE) If TRUE, rarefy
samples using |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
q |
(numeric vector, default |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to ggstatsplot::ggbetweenstats() if you
use this function.
Either an unique ggplot2 object (if one_plot is TRUE) or
a list of ggplot2 plots, one per Hill order in q. With default q:
plot_Hill_0 : the ggbetweenstats of Hill number 0 (= species richness) against the variable fact
plot_Hill_1 : the ggbetweenstats of Hill number 1 (= Shannon index) against the variable fact
plot_Hill_2 : the ggbetweenstats of Hill number 2 (= Simpson index) against the variable fact
Adrien Taudière
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
library("divent") if (requireNamespace("ggstatsplot")) { data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:10], data_fungi_sp_known )) p <- ggbetween_pq(data_f, fact = "Time", p.adjust.method = "BH") p[[1]] } ## Not run: if (requireNamespace("ggstatsplot")) { ggbetween_pq(data_fungi, fact = "Height", one_plot = TRUE) ggbetween_pq(data_fungi, fact = "Height", one_plot = TRUE, rarefy_by_sample = TRUE) } ## End(Not run)library("divent") if (requireNamespace("ggstatsplot")) { data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:10], data_fungi_sp_known )) p <- ggbetween_pq(data_f, fact = "Time", p.adjust.method = "BH") p[[1]] } ## Not run: if (requireNamespace("ggstatsplot")) { ggbetween_pq(data_fungi, fact = "Height", one_plot = TRUE) ggbetween_pq(data_fungi, fact = "Height", one_plot = TRUE, rarefy_by_sample = TRUE) } ## End(Not run)
Basically a wrapper of function ggstatsplot::ggscatterstats() for
object of class phyloseq and Hill number.
ggscatt_pq( physeq, num_modality, q = c(0, 1, 2), rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, one_plot = TRUE, ... )ggscatt_pq( physeq, num_modality, q = c(0, 1, 2), rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, one_plot = TRUE, ... )
physeq |
(required) a |
num_modality |
(required) Name of the numeric column in
|
q |
(a vector of integer) The list of q values to compute
the hill number H^q. If Null, no hill number are computed. Default value
compute the Hill number 0 (Species richness), the Hill number 1
(exponential of Shannon Index) and the Hill number 2 (inverse of Simpson
Index). Hill numbers are more appropriate in DNA metabarcoding studies
when |
rarefy_by_sample |
(logical, default FALSE) If TRUE, rarefy
samples using |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
one_plot |
(logical, default FALSE) If TRUE, return a unique plot with the three plot inside using the patchwork package. |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to ggstatsplot::ggscatterstats() if you
use this function.
Either an unique ggplot2 (when one_plot is TRUE) or
a list of ggplot2 plot for each q.
Adrien Taudière
if (requireNamespace("ggstatsplot")) { library("divent") ggscatt_pq(data_fungi_mini, "Time", q = 0, type = "non-parametric") } if (requireNamespace("ggstatsplot")) { ggscatt_pq(data_fungi_mini, "Sample_id", q = 0, one_plot = FALSE ) }if (requireNamespace("ggstatsplot")) { library("divent") ggscatt_pq(data_fungi_mini, "Time", q = 0, type = "non-parametric") } if (requireNamespace("ggstatsplot")) { ggscatt_pq(data_fungi_mini, "Sample_id", q = 0, one_plot = FALSE ) }
phyloseq-class object using
ggVennDiagram::ggVennDiagram functionNote that you can use ggplot2 function to customize the plot
for ex. + scale_fill_distiller(palette = "BuPu", direction = 1)
and + scale_x_continuous(expand = expansion(mult = 0.5)). See
examples.
ggvenn_pq( physeq = NULL, fact = NULL, min_nb_seq = 0, taxonomic_rank = NULL, split_by = NULL, add_nb_samples = TRUE, add_nb_seq = FALSE, rarefy_before_merging = FALSE, rarefy_after_merging = FALSE, rngseed = FALSE, return_data_for_venn = FALSE, verbose = TRUE, type = "nb_taxa", na_remove = TRUE, ... )ggvenn_pq( physeq = NULL, fact = NULL, min_nb_seq = 0, taxonomic_rank = NULL, split_by = NULL, add_nb_samples = TRUE, add_nb_seq = FALSE, rarefy_before_merging = FALSE, rarefy_after_merging = FALSE, rngseed = FALSE, return_data_for_venn = FALSE, verbose = TRUE, type = "nb_taxa", na_remove = TRUE, ... )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
min_nb_seq |
minimum number of sequences by OTUs by samples to take into count this OTUs in this sample. For example, if min_nb_seq=2,each value of 2 or less in the OTU table will not count in the venn diagram |
taxonomic_rank |
Name (or number) of a taxonomic rank to count. If set to Null (the default) the number of OTUs is counted. |
split_by |
Split into multiple plot using variable split_by.
The name of a variable must be present in |
add_nb_samples |
(logical, default TRUE) Add the number of samples to levels names |
add_nb_seq |
(logical, default FALSE) Add the number of sequences to levels names |
rarefy_before_merging |
Rarefy each sample before merging by the
modalities of args |
rarefy_after_merging |
Rarefy each sample after merging by the
modalities of args |
rngseed |
(Optional). A single integer value passed to
|
return_data_for_venn |
(logical, default FALSE) If TRUE, the plot is not returned, but the resulting dataframe to plot with ggVennDiagram package is returned. |
verbose |
(logical, default TRUE) If TRUE, prompt some messages. |
type |
If "nb_taxa" (default), the number of taxa (ASV, OTU or
taxonomic_rank if |
na_remove |
(logical, default TRUE) If set to TRUE, remove samples with
NA in the variables set in |
... |
Other arguments for the |
A ggplot2 plot representing Venn diagram of
modalities of the argument factor or if split_by is set a list
of plots.
Adrien Taudière
if (requireNamespace("ggVennDiagram")) { ggvenn_pq(data_fungi_mini, fact = "Height") } if (requireNamespace("ggVennDiagram")) { ggvenn_pq(data_fungi_mini, fact = "Height") + ggplot2::scale_fill_distiller(palette = "BuPu", direction = 1) pl <- ggvenn_pq(data_fungi_mini, fact = "Height", split_by = "Time") for (i in seq_along(pl)) { p <- pl[[i]] + scale_fill_distiller(palette = "BuPu", direction = 1) + theme(plot.title = element_text(hjust = 0.5, size = 22)) print(p) } data_fungi2 <- subset_samples( data_fungi_mini, data_fungi_mini@sam_data$Tree_name == "A10-005" | data_fungi_mini@sam_data$Height %in% c("Low", "High") ) ggvenn_pq(data_fungi2, fact = "Height") ggvenn_pq(data_fungi2, fact = "Height", type = "nb_seq") ggvenn_pq(data_fungi_mini, fact = "Height", add_nb_seq = TRUE, set_size = 4) ggvenn_pq(data_fungi_mini, fact = "Height", rarefy_before_merging = TRUE) ggvenn_pq(data_fungi_mini, fact = "Height", rarefy_after_merging = TRUE) + scale_x_continuous(expand = expansion(mult = 0.5)) # For more flexibility, you can save the dataset for more precise construction # with ggplot2 and ggVennDiagramm # (https://gaospecial.github.io/ggVennDiagram/articles/fully-customed.html) res_venn <- ggvenn_pq(data_fungi_mini, fact = "Height", return_data_for_venn = TRUE ) ggplot() + # 1. region count layer geom_polygon(aes(X, Y, group = id, fill = name), data = ggVennDiagram::venn_regionedge(res_venn) ) + scale_fill_manual(values = funky_color(7)) + # 2. set edge layer geom_path(aes(X, Y, color = id, group = id), data = ggVennDiagram::venn_setedge(res_venn), show.legend = FALSE, linewidth = 2 ) + scale_color_manual(values = c("red", "red", "blue")) + # 3. set label layer geom_text(aes(X, Y, label = name), data = ggVennDiagram::venn_setlabel(res_venn) ) + # 4. region label layer geom_label( aes(X, Y, label = paste0( count, " (", scales::percent(count / sum(count), accuracy = 2), ")" )), data = ggVennDiagram::venn_regionlabel(res_venn) ) + theme_void() }if (requireNamespace("ggVennDiagram")) { ggvenn_pq(data_fungi_mini, fact = "Height") } if (requireNamespace("ggVennDiagram")) { ggvenn_pq(data_fungi_mini, fact = "Height") + ggplot2::scale_fill_distiller(palette = "BuPu", direction = 1) pl <- ggvenn_pq(data_fungi_mini, fact = "Height", split_by = "Time") for (i in seq_along(pl)) { p <- pl[[i]] + scale_fill_distiller(palette = "BuPu", direction = 1) + theme(plot.title = element_text(hjust = 0.5, size = 22)) print(p) } data_fungi2 <- subset_samples( data_fungi_mini, data_fungi_mini@sam_data$Tree_name == "A10-005" | data_fungi_mini@sam_data$Height %in% c("Low", "High") ) ggvenn_pq(data_fungi2, fact = "Height") ggvenn_pq(data_fungi2, fact = "Height", type = "nb_seq") ggvenn_pq(data_fungi_mini, fact = "Height", add_nb_seq = TRUE, set_size = 4) ggvenn_pq(data_fungi_mini, fact = "Height", rarefy_before_merging = TRUE) ggvenn_pq(data_fungi_mini, fact = "Height", rarefy_after_merging = TRUE) + scale_x_continuous(expand = expansion(mult = 0.5)) # For more flexibility, you can save the dataset for more precise construction # with ggplot2 and ggVennDiagramm # (https://gaospecial.github.io/ggVennDiagram/articles/fully-customed.html) res_venn <- ggvenn_pq(data_fungi_mini, fact = "Height", return_data_for_venn = TRUE ) ggplot() + # 1. region count layer geom_polygon(aes(X, Y, group = id, fill = name), data = ggVennDiagram::venn_regionedge(res_venn) ) + scale_fill_manual(values = funky_color(7)) + # 2. set edge layer geom_path(aes(X, Y, color = id, group = id), data = ggVennDiagram::venn_setedge(res_venn), show.legend = FALSE, linewidth = 2 ) + scale_color_manual(values = c("red", "red", "blue")) + # 3. set label layer geom_text(aes(X, Y, label = name), data = ggVennDiagram::venn_setlabel(res_venn) ) + # 4. region label layer geom_label( aes(X, Y, label = paste0( count, " (", scales::percent(count / sum(count), accuracy = 2), ")" )), data = ggVennDiagram::venn_regionlabel(res_venn) ) + theme_void() }
See glmulti::glmulti() for more information.
glmutli_pq( physeq, formula, fitfunction = "lm", q = c(0, 1, 2), aic_step = 2, confsetsize = 100, plotty = FALSE, level = 1, method = "h", crit = "aicc", ... )glmutli_pq( physeq, formula, fitfunction = "lm", q = c(0, 1, 2), aic_step = 2, confsetsize = 100, plotty = FALSE, level = 1, method = "h", crit = "aicc", ... )
physeq |
(required) a |
formula |
(required) a formula for |
fitfunction |
(default "lm") |
q |
(a vector of integer) The list of q values to compute
the hill number H^q. If Null, no hill number are computed. Default value
compute the Hill number 0 (Species richness), the Hill number 1
(exponential of Shannon Index) and the Hill number 2 (inverse of Simpson
Index). Hill numbers are more appropriate in DNA metabarcoding studies
when |
aic_step |
The value between AIC scores to cut for. |
confsetsize |
The number of models to be looked for, i.e. the size of the returned confidence set. |
plotty |
(logical) Whether to plot the progress of the IC profile when running. |
level |
If 1, only main effects (terms of order 1) are used to build the candidate set. If 2, pairwise interactions are also used (higher order interactions are currently ignored) |
method |
The method to be used to explore the candidate set of models. If "h" (default) an exhaustive screening is undertaken. If "g" the genetic algorithm is employed (recommended for large candidate sets). If "l", a very fast exhaustive branch-and-bound algorithm is used. Package leaps must then be loaded, and this can only be applied to linear models with covariates and no interactions. If "d", a simple summary of the candidate set is printed, including the number of candidate models. |
crit |
(character, default aicc) The Information Criterion to be used. Default is the small-sample corrected AIC (aicc). This should be a function that accepts a fitted model as first argument. Other provided functions are the classic AIC, the Bayes IC (bic), and QAIC/QAICc (qaic and qaicc). |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to glmulti::glmulti() if you
use this function.
A data.frame summarizing the glmulti results with columns
-estimates -unconditional_interval -nb_model" -importance -alpha
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
if (requireNamespace("glmulti")) { library("divent") res_glmulti <- glmutli_pq(data_fungi_mini, "Hill_0 ~ Hill_1 + Abundance + Time + Height", level = 1 ) res_glmulti res_glmulti_interaction <- glmutli_pq(data_fungi_mini, "Hill_0 ~ Abundance + Time + Height", level = 2 ) res_glmulti_interaction }if (requireNamespace("glmulti")) { library("divent") res_glmulti <- glmutli_pq(data_fungi_mini, "Hill_0 ~ Hill_1 + Abundance + Time + Height", level = 1 ) res_glmulti res_glmulti_interaction <- glmutli_pq(data_fungi_mini, "Hill_0 ~ Abundance + Time + Height", level = 2 ) res_glmulti_interaction }
Pure-R implementation of the Geometric Mean of Pairwise Ratios normalization (Chen et al. 2018, doi:10.7717/peerj.4600) tailored for zero-inflated count tables such as microbial OTU tables. Returns counts divided by the per-sample GMPR size factors.
gmpr_pq(physeq, intersect_no = 4, ct_min = 2)gmpr_pq(physeq, intersect_no = 4, ct_min = 2)
physeq |
(required) a |
intersect_no |
(integer, default 4) minimum number of shared taxa between two samples for the pairwise ratio to be computed. |
ct_min |
(integer, default 2) minimum count for a taxon to be considered "shared" between two samples. |
A new phyloseq-class object with a
GMPR-normalised otu_table. Size factors are stored as an attribute
"gmpr_size_factors" on the otu_table.
Adrien Taudière
Chen L. et al. (2018) GMPR: a robust normalization method for zero-inflated count data with application to microbiome sequencing data. PeerJ 6:e4600. doi:10.7717/peerj.4600
data_f_gmpr <- gmpr_pq(data_fungi_mini) sample_sums(data_f_gmpr)data_f_gmpr <- gmpr_pq(data_fungi_mini) sample_sums(data_f_gmpr)
A wrapper of phyloseqGraphTest::graph_perm_test() for quick plot with
important statistics
graph_test_pq( physeq, fact, merge_sample_by = NULL, nperm = 999, return_plot = TRUE, title = "Graph Test", na_remove = FALSE, ... )graph_test_pq( physeq, fact, merge_sample_by = NULL, nperm = 999, return_plot = TRUE, title = "Graph Test", na_remove = FALSE, ... )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
merge_sample_by |
a vector to determine
which samples to merge using |
nperm |
(int) The number of permutations to perform. |
return_plot |
(logical) Do we return only the result of the test, or do we plot the result? |
title |
The title of the Graph. |
na_remove |
(logical, default FALSE) If set to TRUE, remove samples with NA in the variables set in formula. |
... |
Other params for be passed on to
|
This function is mainly a wrapper of the work of others.
Please cite phyloseqGraphTest package.
A ggplot2 plot with a subtitle indicating the pvalue
and the number of permutations
Adrien Taudière
if (requireNamespace("phyloseqGraphTest")) { data(enterotype) graph_test_pq(enterotype, fact = "SeqTech") graph_test_pq(enterotype, fact = "Enterotype", na_remove = TRUE) }if (requireNamespace("phyloseqGraphTest")) { data(enterotype) graph_test_pq(enterotype, fact = "SeqTech") graph_test_pq(enterotype, fact = "Enterotype", na_remove = TRUE) }
Computes Hill diversity accumulation curves from a phyloseq object
and returns a ggplot2 object.
Two types of curves are available:
type = "individual" (default): individual-based (sequence-based)
rarefaction/extrapolation curves via divent::accum_hill(), with one
curve per sample (or per merged group).
type = "sample": sample-based accumulation curve. Samples are pooled
incrementally (over random permutations) and Hill diversity is computed
at each step using divent::div_hill(). The x-axis represents the
number of samples.
hill_acc_pq( physeq, q = 1, type = c("individual", "sample"), merge_sample_by = NULL, n_permutations = 100, conf_level = 0.95, ... )hill_acc_pq( physeq, q = 1, type = c("individual", "sample"), merge_sample_by = NULL, n_permutations = 100, conf_level = 0.95, ... )
physeq |
(required) a |
q |
(numeric, default 1) Hill diversity order. Default is 1 (exponential of Shannon entropy), recommended for its robustness against rare and potentially erroneous sequences (Alberdi & Gilbert, 2019; Calderón-Sanou et al., 2019). |
type |
(character) Type of accumulation curve. Either |
merge_sample_by |
(character or NULL) Variable name in
|
n_permutations |
(integer, default 100) Number of random sample
orderings used to compute the mean and confidence envelope for
sample-based accumulation. Ignored when |
conf_level |
(numeric, default 0.95) Confidence level for the
envelope around sample-based accumulation curves. Ignored when
|
... |
Additional arguments passed to |
A ggplot2 object.
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
divent::accum_hill(), divent::div_hill(), hill_curves_pq()
## Not run: # Individual (sequence-based) accumulation curves hill_acc_pq(rarefy_pq(data_fungi_mini, sample_size = 500, replace = TRUE), n_permutations = 3 ) + no_legend() hill_acc_pq(rarefy_pq(data_fungi_mini, sample_size = 500, replace = TRUE), n_permutations = 3, merge_sample_by = "Height" ) # Sample-based accumulation curve hill_acc_pq(data_fungi_mini, type = "sample", n_permutations = 3) hill_acc_pq(data_fungi_mini, type = "sample", merge_sample_by = "Height", n_permutations = 3 ) ## End(Not run)## Not run: # Individual (sequence-based) accumulation curves hill_acc_pq(rarefy_pq(data_fungi_mini, sample_size = 500, replace = TRUE), n_permutations = 3 ) + no_legend() hill_acc_pq(rarefy_pq(data_fungi_mini, sample_size = 500, replace = TRUE), n_permutations = 3, merge_sample_by = "Height" ) # Sample-based accumulation curve hill_acc_pq(data_fungi_mini, type = "sample", n_permutations = 3) hill_acc_pq(data_fungi_mini, type = "sample", merge_sample_by = "Height", n_permutations = 3 ) ## End(Not run)
For each Hill diversity order in q, draws a bar at the group mean (±1 SE)
with jittered individual points. A Kruskal-Wallis test is reported in the
subtitle; when the global effect is significant, Tukey HSD pairwise
comparisons produce compact letter displays above the bars. Multiple values
of q are assembled into a patchwork layout automatically.
hill_bar_pq( physeq, x, q = c(0, 2), fill, x_lab = NULL, y_labs = NULL, ncol = NULL, alpha = 0.6, point_size = 3, base_size = 13, jitter_width = 0.15, bar_width = 0.7, add_letters = TRUE, p_threshold = 0.05, letter_size = 5, letters_top_offset = 0.05, y_lab_size = NULL, x_lab_size = NULL, show_n_samples = TRUE, palette = c("#E69F00", "#56B4E9", "#009E73", "#F0E442", "#0072B2", "#D55E00", "#CC79A7", "#000000"), error_fun = function(x) { m <- mean(x, na.rm = TRUE) se <- sd(x, na.rm = TRUE)/sqrt(sum(!is.na(x))) c(lower = m - se, upper = m + se) }, error_fun_lab = "mean ± SE", error_bar_alpha = 0.35, point_alpha = 0.5, letters_below_bar = FALSE, ... )hill_bar_pq( physeq, x, q = c(0, 2), fill, x_lab = NULL, y_labs = NULL, ncol = NULL, alpha = 0.6, point_size = 3, base_size = 13, jitter_width = 0.15, bar_width = 0.7, add_letters = TRUE, p_threshold = 0.05, letter_size = 5, letters_top_offset = 0.05, y_lab_size = NULL, x_lab_size = NULL, show_n_samples = TRUE, palette = c("#E69F00", "#56B4E9", "#009E73", "#F0E442", "#0072B2", "#D55E00", "#CC79A7", "#000000"), error_fun = function(x) { m <- mean(x, na.rm = TRUE) se <- sd(x, na.rm = TRUE)/sqrt(sum(!is.na(x))) c(lower = m - se, upper = m + se) }, error_fun_lab = "mean ± SE", error_bar_alpha = 0.35, point_alpha = 0.5, letters_below_bar = FALSE, ... )
physeq |
(required) a |
x |
Name (unquoted) of the grouping variable in |
q |
Numeric vector of Hill diversity orders to plot. The corresponding
|
fill |
Name (unquoted) of the fill aesthetic column. Defaults to |
x_lab |
Label for the x-axis. Defaults to the column name of |
y_labs |
Named character vector of y-axis labels keyed by |
ncol |
Number of columns in the patchwork layout when |
alpha |
Transparency of bars. Default |
point_size |
Size of jittered points. Default |
base_size |
Base font size in pts. Default |
jitter_width |
Horizontal jitter width. Default |
bar_width |
Width of bars. Default |
add_letters |
Logical. Add compact letter display above bars.
Requires the multcompView package. Default |
p_threshold |
Significance threshold for the Kruskal-Wallis test.
Below this value, Tukey HSD pairwise comparisons are run and letters
assigned; above it all groups receive |
letter_size |
Size of letter labels in ggplot2 units. Default |
letters_top_offset |
Fraction of the y-range added above the highest
point / error-bar to position letters. Default |
y_lab_size |
Size of y-axis tick labels in pts. Defaults to |
x_lab_size |
Size of x-axis tick labels in pts. Defaults to |
show_n_samples |
Logical. If |
palette |
Character vector of fill colours. Defaults to the Okabe-Ito palette. |
error_fun |
Function taking a numeric vector and returning a 2-element
numeric vector |
error_fun_lab |
Label for the error bar used in the plot caption.
Default |
error_bar_alpha |
Transparency of the secondary top-half error bar
drawn over the jittered points to hint at the upper extent without
obscuring data. Default |
point_alpha |
Transparency of the jittered data points. Default |
letters_below_bar |
Logical. When |
... |
Additional arguments passed to |
A ggplot object when length(q) == 1, or a patchwork object
when length(q) > 1.
Adrien Taudière
hill_pq(), psmelt_samples_pq(), ggbetween_pq()
hill_bar_pq(data_fungi_mini, Height, q = 1) ## Not run: hill_bar_pq(data_fungi_mini, Height, q = 0) hill_bar_pq(data_fungi_mini, Height, q = c(0, 1, 2), ncol = 1) hill_bar_pq(data_fungi_mini, Height, q = c(0, 2), y_labs = c(Hill_0 = "Richness", Hill_2 = "Simpson diversity") ) hill_bar_pq(data_fungi_mini, Height, add_letters = FALSE) ## End(Not run)hill_bar_pq(data_fungi_mini, Height, q = 1) ## Not run: hill_bar_pq(data_fungi_mini, Height, q = 0) hill_bar_pq(data_fungi_mini, Height, q = c(0, 1, 2), ncol = 1) hill_bar_pq(data_fungi_mini, Height, q = c(0, 2), y_labs = c(Hill_0 = "Richness", Hill_2 = "Simpson diversity") ) hill_bar_pq(data_fungi_mini, Height, add_letters = FALSE) ## End(Not run)
Basically a wrapper of vegan::renyi() and
vegan::renyiaccum() functions
hill_curves_pq( physeq, merge_sample_by = NULL, color_fac = NULL, q = c(0, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, Inf), nperm = NULL, na_remove = TRUE, wrap_factor = TRUE, plot_legend = TRUE, linewidth = 2, size_point = 2, ... )hill_curves_pq( physeq, merge_sample_by = NULL, color_fac = NULL, q = c(0, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, Inf), nperm = NULL, na_remove = TRUE, wrap_factor = TRUE, plot_legend = TRUE, linewidth = 2, size_point = 2, ... )
physeq |
(required) a |
merge_sample_by |
a vector to determine which samples to merge using
the |
color_fac |
(optional): The variable to color the barplot. For ex. same as fact. If merge_sample_by is set, color_fac must be nested in the mq_by factor. See examples. |
q |
Scales of Rényi diversity. |
nperm |
(int Default NULL) If a integer is set to nperm, nperm
permutation are computed to draw confidence interval for each curves.
The function use |
na_remove |
(logical, default FALSE) If set to TRUE, remove samples with NA in the variables set in merge_sample_by. Not used if merge_sample_by is NULL. |
wrap_factor |
(logical, default TRUE) Do the plot is wrap by the factor |
plot_legend |
(logical, default TRUE) If set to FALSE, no legend are plotted. |
linewidth |
(int, default 2) The linewidth of lines. |
size_point |
(int, default 1) The size of the point. |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::renyi() or
vegan::renyiaccum() functions
A ggplot2 object
Adrien Taudière
if (requireNamespace("vegan")) { hill_curves_pq(data_fungi_mini, merge_sample_by = "Time") hill_curves_pq(data_fungi_mini, color_fac = "Time", plot_legend = FALSE) hill_curves_pq(data_fungi_mini, color_fac = "Time", plot_legend = FALSE, nperm = 9, size_point = 1, linewidth = 0.5 ) hill_curves_pq(data_fungi_mini, nperm = 9, plot_legend = FALSE, size_point = 1, linewidth = 0.5 ) hill_curves_pq(data_fungi_mini, "Height", q = c(0, 1, 2, 8), plot_legend = FALSE ) hill_curves_pq(data_fungi_mini, "Height", q = c(0, 0.5, 1, 2, 4, 8), nperm = 9 ) hill_curves_pq(data_fungi_mini, "Height", nperm = 9, wrap_factor = FALSE) data_fungi_mini@sam_data$H_T <- paste0( data_fungi_mini@sam_data$Height, "_", data_fungi_mini@sam_data$Time ) merge_samples2(data_fungi_mini, "H_T") hill_curves_pq(data_fungi_mini, "H_T", color_fac = "Time", nperm = 9) }if (requireNamespace("vegan")) { hill_curves_pq(data_fungi_mini, merge_sample_by = "Time") hill_curves_pq(data_fungi_mini, color_fac = "Time", plot_legend = FALSE) hill_curves_pq(data_fungi_mini, color_fac = "Time", plot_legend = FALSE, nperm = 9, size_point = 1, linewidth = 0.5 ) hill_curves_pq(data_fungi_mini, nperm = 9, plot_legend = FALSE, size_point = 1, linewidth = 0.5 ) hill_curves_pq(data_fungi_mini, "Height", q = c(0, 1, 2, 8), plot_legend = FALSE ) hill_curves_pq(data_fungi_mini, "Height", q = c(0, 0.5, 1, 2, 4, 8), nperm = 9 ) hill_curves_pq(data_fungi_mini, "Height", nperm = 9, wrap_factor = FALSE) data_fungi_mini@sam_data$H_T <- paste0( data_fungi_mini@sam_data$Height, "_", data_fungi_mini@sam_data$Time ) merge_samples2(data_fungi_mini, "H_T") hill_curves_pq(data_fungi_mini, "H_T", color_fac = "Time", nperm = 9) }
Hill numbers are the number of equiprobable species giving the same diversity value as the observed distribution. The Hill number 0 correspond to Species richness), the Hill number 1 to the exponential of Shannon Index and the Hill number 2 to the inverse of Simpson Index)
Note that (if correction_for_sample_size is TRUE, default behavior) this function use a sqrt of the read numbers in the linear model in order to correct for uneven sampling depth. This correction is only done before tuckey HSD plot and do not change the hill number computed.
hill_pq( physeq, fact = NULL, variable = NULL, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), color_fac = NA, letters = FALSE, add_points = FALSE, add_info = TRUE, kruskal_test = TRUE, one_plot = FALSE, plot_with_tuckey = TRUE, correction_for_sample_size = TRUE, na_remove = TRUE, vioplot = FALSE, ... )hill_pq( physeq, fact = NULL, variable = NULL, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), color_fac = NA, letters = FALSE, add_points = FALSE, add_info = TRUE, kruskal_test = TRUE, one_plot = FALSE, plot_with_tuckey = TRUE, correction_for_sample_size = TRUE, na_remove = TRUE, vioplot = FALSE, ... )
physeq |
(required) a |
fact |
(required) The variable to test. Must be present in
the |
variable |
: Alias for factor. Kept only for backward compatibility. |
q |
(vector) Hill diversity orders to compute. Default computes
Hill number 0 (species richness), 1 (exponential of Shannon index) and
2 (inverse of Simpson index). Hill numbers are more appropriate in DNA
metabarcoding studies when |
hill_scales |
|
color_fac |
(optional): The variable to color the barplot. For ex.
same as fact. Not very useful because ggplot2 plot colors can be
change using |
letters |
(optional, default FALSE): If set to TRUE, the plot
show letters based on p-values for comparison. Use the
|
add_points |
(logical, default FALSE): add jitter point on boxplot |
add_info |
(logical, default TRUE) Do we add a subtitle with information about the number of samples per modality ? |
kruskal_test |
(logical, default TRUE) Do we test for global effect of our factor on each hill scales values? When kruskal_test is TRUE, the resulting test value are add in each plot in subtitle (unless add_info is FALSE). Moreover, if at least one hill scales is not significantly link to fact (pval>0.05), a message is prompt saying that Tuckey HSD plot is not informative for those Hill scales and letters are not printed. |
one_plot |
(logical, default FALSE) If TRUE, return a unique plot with the four plot inside using the patchwork package. Note that if letters and one_plot are both TRUE, tuckey HSD results are discarded from the unique plot. In that case, use one_plot = FALSE to see the tuckey HSD results in the fourth plot of the resulting list. |
plot_with_tuckey |
(logical, default TRUE). If one_plot is set to TRUE and letters to FALSE, allow to discard the tuckey plot part with plot_with_tuckey = FALSE |
correction_for_sample_size |
(logical, default TRUE) This function
use a sqrt of the read numbers in the linear model in order to
correct for uneven sampling depth in the Tuckey TEST. This params
do not change value of Hill number but only the test associated
values (including the pvalues). To rarefy samples, you may use the
function |
na_remove |
(logical, default TRUE) Do we remove samples with NA in the factor fact ? Note that na_remove is always TRUE when using letters = TRUE |
vioplot |
(logical, default FALSE) Do we plot violin plot instead of boxplot ? |
... |
Additional arguments passed to |
Either an unique ggplot2 object (if one_plot is TRUE) or a list of n+1 ggplot2 plot (with n the number of hill scale value). For example, with the default scale value:
plot_Hill_0 : the boxplot of Hill number 0 (= species richness) against the variable
plot_Hill_1 : the boxplot of Hill number 1 (= Shannon index) against the variable
plot_Hill_2 : the boxplot of Hill number 2 (= Simpson index) against the variable
plot_tuckey : plot the result of the Tuckey HSD test
Adrien Taudière
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
psmelt_samples_pq() and ggbetween_pq()
data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) p <- hill_pq(data_f, "Height", q = c(0, 1)) p[[1]] + theme(legend.position = "none") ## Not run: if (requireNamespace("multcompView")) { p2 <- hill_pq(data_fungi_mini, "Time", correction_for_sample_size = FALSE, letters = TRUE, add_points = TRUE, plot_with_tuckey = FALSE ) if (requireNamespace("patchwork")) { patchwork::wrap_plots(p2, guides = "collect") } p3 <- hill_pq(data_fungi_mini, "Height", letters = TRUE, vioplot = TRUE, add_points = TRUE ) } ## End(Not run)data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) p <- hill_pq(data_f, "Height", q = c(0, 1)) p[[1]] + theme(legend.position = "none") ## Not run: if (requireNamespace("multcompView")) { p2 <- hill_pq(data_fungi_mini, "Time", correction_for_sample_size = FALSE, letters = TRUE, add_points = TRUE, plot_with_tuckey = FALSE ) if (requireNamespace("patchwork")) { patchwork::wrap_plots(p2, guides = "collect") } p3 <- hill_pq(data_fungi_mini, "Height", letters = TRUE, vioplot = TRUE, add_points = TRUE ) } ## End(Not run)
This reduce the risk of a random drawing of a exceptional situation of an unique rarefaction.
hill_test_rarperm_pq( physeq, fact, q = c(0, 1, 2), nperm = 99, sample.size = min(sample_sums(physeq)), verbose = FALSE, progress_bar = TRUE, p_val_signif = 0.05, type = "nonparametric", ... )hill_test_rarperm_pq( physeq, fact, q = c(0, 1, 2), nperm = 99, sample.size = min(sample_sums(physeq)), verbose = FALSE, progress_bar = TRUE, p_val_signif = 0.05, type = "nonparametric", ... )
physeq |
(required) a |
fact |
(required) Name of the factor in |
q |
(a vector of integer) The list of q values to compute
the hill number H^q. If Null, no hill number are computed. Default value
compute the Hill number 0 (Species richness), the Hill number 1
(exponential of Shannon Index) and the Hill number 2 (inverse of Simpson
Index). Hill numbers are more appropriate in DNA metabarcoding studies
when |
nperm |
(int) The number of permutations to perform. |
sample.size |
(int) A single integer value equal to the number of
reads being simulated, also known as the depth. See
|
verbose |
(logical). If TRUE, print additional information. |
progress_bar |
(logical, default TRUE) Do we print progress during the calculation? |
p_val_signif |
(float, |
type |
A character specifying the type of statistical approach
(See
|
... |
Additional arguments passed on to |
A list of 6 components :
method
expressions
plots
pvals
prop_signif
statistics
Adrien Taudière
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
ggstatsplot::ggbetweenstats(), hill_pq()
## Not run: if (requireNamespace("ggstatsplot")) { hill_test_rarperm_pq(data_fungi, "Time", nperm = 3) res <- hill_test_rarperm_pq(data_fungi, "Height", nperm = 3, p_val_signif = 0.9 ) patchwork::wrap_plots(res$plots[[1]]) res$plots[[1]][[1]] + res$plots[[2]][[1]] + res$plots[[3]][[1]] res$prop_signif res_para <- hill_test_rarperm_pq(data_fungi, "Height", nperm = 3, type = "parametric" ) res_para$plots[[1]][[1]] + res_para$plots[[2]][[1]] + res_para$plots[[3]][[1]] res_para$pvals res_para$method res_para$expressions[[1]] } ## End(Not run)## Not run: if (requireNamespace("ggstatsplot")) { hill_test_rarperm_pq(data_fungi, "Time", nperm = 3) res <- hill_test_rarperm_pq(data_fungi, "Height", nperm = 3, p_val_signif = 0.9 ) patchwork::wrap_plots(res$plots[[1]]) res$plots[[1]][[1]] + res$plots[[2]][[1]] + res$plots[[3]][[1]] res$prop_signif res_para <- hill_test_rarperm_pq(data_fungi, "Height", nperm = 3, type = "parametric" ) res_para$plots[[1]][[1]] + res_para$plots[[2]][[1]] + res_para$plots[[3]][[1]] res_para$pvals res_para$method res_para$expressions[[1]] } ## End(Not run)
Note that, by default, this function use a sqrt of the read numbers in the linear model in order to correct for uneven sampling depth.
hill_tuckey_pq( physeq, modality, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), silent = TRUE, correction_for_sample_size = TRUE, ... )hill_tuckey_pq( physeq, modality, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), silent = TRUE, correction_for_sample_size = TRUE, ... )
physeq |
(required) a |
modality |
(required) the variable to test |
q |
(numeric vector) Hill diversity orders to compute (q values).
Default computes Hill number 0 (species richness), Hill number 1
(exponential of Shannon index) and Hill number 2 (inverse of Simpson
index). Formerly |
hill_scales |
|
silent |
(logical) If TRUE, no message are printing. |
correction_for_sample_size |
(logical, default TRUE) This function use a sqrt of the read numbers in the linear model in order to correct for uneven sampling depth. |
... |
Additional arguments passed to |
A ggplot2 object
Adrien Taudière
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) hill_tuckey_pq(data_f, "Height")data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) hill_tuckey_pq(data_f, "Height")
Note that this function is quite time-consuming due to high dimensionality in metabarcoding community matrix.
iNEXT_pq(physeq, merge_sample_by = NULL, ...)iNEXT_pq(physeq, merge_sample_by = NULL, ...)
physeq |
(required) a |
merge_sample_by |
(default: NULL) if not |
... |
Other arguments for the |
see iNEXT::iNEXT() documentation
Adrien Taudière
This function is mainly a wrapper of the work of others.
Please make a reference to iNEXT::iNEXT() if you
use this function.
## Not run: if (requireNamespace("iNEXT")) { data("GlobalPatterns", package = "phyloseq") GPsubset <- subset_taxa( GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Bacteria" ) GPsubset <- subset_taxa( GPsubset, rowSums(GPsubset@otu_table) > 20000 ) GPsubset <- subset_taxa( GPsubset, rowSums(is.na(GPsubset@tax_table)) == 0 ) GPsubset@sam_data$human <- GPsubset@sam_data$SampleType %in% c("Skin", "Feces", "Tong") res_iNEXT <- iNEXT_pq( GPsubset, merge_sample_by = "human", q = 1, datatype = "abundance", nboot = 2 ) iNEXT::ggiNEXT(res_iNEXT) # iNEXT::ggiNEXT(res_iNEXT, type = 2) # iNEXT::ggiNEXT(res_iNEXT, type = 3) } ## End(Not run)## Not run: if (requireNamespace("iNEXT")) { data("GlobalPatterns", package = "phyloseq") GPsubset <- subset_taxa( GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Bacteria" ) GPsubset <- subset_taxa( GPsubset, rowSums(GPsubset@otu_table) > 20000 ) GPsubset <- subset_taxa( GPsubset, rowSums(is.na(GPsubset@tax_table)) == 0 ) GPsubset@sam_data$human <- GPsubset@sam_data$SampleType %in% c("Skin", "Feces", "Tong") res_iNEXT <- iNEXT_pq( GPsubset, merge_sample_by = "human", q = 1, datatype = "abundance", nboot = 2 ) iNEXT::ggiNEXT(res_iNEXT) # iNEXT::ggiNEXT(res_iNEXT, type = 2) # iNEXT::ggiNEXT(res_iNEXT, type = 3) } ## End(Not run)
Downloads a pre-compiled MMseqs2 binary from
https://mmseqs.com/latest/ and places it in the user data
directory for this package. Subsequent calls to find_mmseqs2() will
find it automatically.
install_mmseqs2( version = "latest", path = tools::R_user_dir("MiscMetabar", "data"), force = FALSE )install_mmseqs2( version = "latest", path = tools::R_user_dir("MiscMetabar", "data"), force = FALSE )
version |
Character. Either |
path |
Destination directory (default:
|
force |
Logical. Re-download even if already installed? |
The path to the installed binary (invisibly).
Adrien Taudière
find_mmseqs2(), is_mmseqs2_installed(), assign_mmseqs2()
## Not run: install_mmseqs2() install_mmseqs2(force = TRUE) ## End(Not run)## Not run: install_mmseqs2() install_mmseqs2(force = TRUE) ## End(Not run)
Downloads and installs the vsearch binary from GitHub into the MiscMetabar user data directory. This is especially useful on Windows where vsearch is not available from a system package manager.
After installation, all MiscMetabar functions that use vsearch will
find the binary automatically via find_vsearch().
install_vsearch( version = "latest", path = tools::R_user_dir("MiscMetabar", "data"), force = FALSE )install_vsearch( version = "latest", path = tools::R_user_dir("MiscMetabar", "data"), force = FALSE )
version |
(default: "latest") The vsearch version to install
(e.g. |
path |
(default: |
force |
(default: FALSE) If |
The path to the installed vsearch binary (invisibly).
Adrien Taudière
find_vsearch(), is_vsearch_installed()
## Not run: install_vsearch() install_vsearch(version = "2.30.5") ## End(Not run)## Not run: install_vsearch() install_vsearch(version = "2.30.5") ## End(Not run)
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_cutadapt_installed( args_before_cutadapt = "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv && " )is_cutadapt_installed( args_before_cutadapt = "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv && " )
args_before_cutadapt |
: (String) A one line bash command to run before to run cutadapt. For examples, "source ~/miniconda3/etc/profile.d/conda.sh && conda activate cutadaptenv &&" allow to bypass the conda init which asks to restart the shell |
A logical that say if cutadapt is install in
Adrien Taudière
MiscMetabar::is_cutadapt_installed()MiscMetabar::is_cutadapt_installed()
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_falco_installed(path = "falco")is_falco_installed(path = "falco")
path |
(default: falco) Path to falco |
A logical that say if falco is install in
Adrien Taudière
MiscMetabar::is_falco_installed()MiscMetabar::is_falco_installed()
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_krona_installed(path = "ktImportKrona")is_krona_installed(path = "ktImportKrona")
path |
(default: krona) Path to krona |
A logical that say if krona is install in
Adrien Taudière
MiscMetabar::is_krona_installed()MiscMetabar::is_krona_installed()
Tries to run mmseqs version and returns TRUE if it succeeds.
is_mmseqs2_installed(path = find_mmseqs2())is_mmseqs2_installed(path = find_mmseqs2())
path |
Path to the |
Logical.
Adrien Taudière
find_mmseqs2(), install_mmseqs2(), assign_mmseqs2()
is_mmseqs2_installed()is_mmseqs2_installed()
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_mumu_installed(path = "mumu")is_mumu_installed(path = "mumu")
path |
(default: mumu) Path to mumu |
A logical that say if mumu is install in
Adrien Taudière
MiscMetabar::is_mumu_installed()MiscMetabar::is_mumu_installed()
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_swarm_installed(path = "swarm")is_swarm_installed(path = "swarm")
path |
(default: swarm) Path to falco |
A logical that say if swarm is install in
Adrien Taudière
MiscMetabar::is_swarm_installed()MiscMetabar::is_swarm_installed()
Useful for testthat and examples compilation for R CMD CHECK and test coverage
is_vsearch_installed(path = find_vsearch())is_vsearch_installed(path = find_vsearch())
path |
(default: |
A logical that say if vsearch is install in
Adrien Taudière
find_vsearch(), install_vsearch()
MiscMetabar::is_vsearch_installed()MiscMetabar::is_vsearch_installed()
Need the installation of kronatools on the computer (installation instruction).
krona( physeq, file_path = "krona.html", nb_seq = TRUE, ranks = "All", add_unassigned_rank = 0, name = NULL )krona( physeq, file_path = "krona.html", nb_seq = TRUE, ranks = "All", add_unassigned_rank = 0, name = NULL )
physeq |
(required) a |
file_path |
(required) the location of the html file to save |
nb_seq |
(logical) If true, Krona set the distribution of sequences in the taxonomy. If False, Krona set the distribution of ASVs in the taxonomy. |
ranks |
Number of the taxonomic ranks to plot
(num of the column in |
add_unassigned_rank |
(int) Add unassigned for rank inferior to 'add_unassigned_rank' when necessary. |
name |
A name for intermediary files, Useful to name
your krona result files before merging using |
This function is mainly a wrapper of the work of others. Please cite Krona if you use this function.
A html file
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GA <- subset_taxa(GlobalPatterns, Phylum == "Acidobacteria") ## Not run: krona(GA, "Number.of.sequences.html") krona(GA, "Number.of.ASVs.html", nb_seq = FALSE) merge_krona(c("Number.of.sequences.html", "Number.of.ASVs.html")) ## End(Not run)data("GlobalPatterns", package = "phyloseq") GA <- subset_taxa(GlobalPatterns, Phylum == "Acidobacteria") ## Not run: krona(GA, "Number.of.sequences.html") krona(GA, "Number.of.ASVs.html", nb_seq = FALSE) merge_krona(c("Number.of.sequences.html", "Number.of.ASVs.html")) ## End(Not run)
A wrapper for the adespatial::beta.div() function in the case of physeq
object.
LCBD_pq(physeq, p_adjust_method = "BH", ...)LCBD_pq(physeq, p_adjust_method = "BH", ...)
physeq |
(required) a |
p_adjust_method |
(chr, default "BH"): the method used to adjust p-value |
... |
Additional arguments passed on to |
An object of class beta.div see adespatial::beta.div() function
for more information
Adrien Taudière
This function is mainly a wrapper of the work of others.
Please make a reference to adespatial::beta.div() if you
use this function.
plot_LCBD_pq, adespatial::beta.div()
if (requireNamespace("adespatial")) { data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:10], data_fungi_sp_known )) res <- LCBD_pq(data_f, nperm = 5) str(res) length(res$LCBD) length(res$SCBD) } if (requireNamespace("adespatial")) { LCBD_pq(data_fungi_sp_known, nperm = 5, method = "jaccard") }if (requireNamespace("adespatial")) { data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:10], data_fungi_sp_known )) res <- LCBD_pq(data_f, nperm = 5) str(res) length(res$LCBD) length(res$SCBD) } if (requireNamespace("adespatial")) { LCBD_pq(data_fungi_sp_known, nperm = 5, method = "jaccard") }
DECIPHER::LearnTaxa()
This function is basically a wrapper of functions DECIPHER::LearnTaxa(),
please cite the DECIPHER package if you use this function.
learn_idtaxa( fasta_for_training, output_Rdata = NULL, output_path_only = FALSE, unite = FALSE, ... )learn_idtaxa( fasta_for_training, output_Rdata = NULL, output_path_only = FALSE, unite = FALSE, ... )
fasta_for_training |
A fasta file (can be gzip) to train the trainingSet
using the function The reference database must contain taxonomic information in the header of each sequence in the form of a string starting with ";tax=" and followed by a comma-separated list of up to nine taxonomic identifiers. The only exception is if |
output_Rdata |
A vector naming the path to an output Rdata file. If left to NULL, no Rdata file is written. |
output_path_only |
(logical, default FALSE). If TRUE, the function return only the path to the output_Rdata file. Note that output_Rdata must be set. |
unite |
(logical, default FALSE). If set to TRUE, the fasta_for_training file is formatted from UNITE format to sintax one, needed in fasta_for_training. Only used if trainingSet is NULL. |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to DECIPHER::LearnTaxa() if you
use this function.
Either a Taxa Train object (see DECIPHER::LearnTaxa()) or, if
output_path_only is TRUE, a vector indicating the path to the output
training object.
Adrien Taudière
## Not run: training_mini_UNITE_fungi <- learn_idtaxa(fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" )) plot(training_mini_UNITE_fungi) training_100sp_UNITE <- learn_idtaxa( fasta_for_training = system.file("extdata", "100_sp_UNITE_sh_general_release_dynamic.fasta", package = "MiscMetabar" ), unite = TRUE ) plot(training_100sp_UNITE) ## End(Not run)## Not run: training_mini_UNITE_fungi <- learn_idtaxa(fasta_for_training = system.file("extdata", "mini_UNITE_fungi.fasta.gz", package = "MiscMetabar" )) plot(training_mini_UNITE_fungi) training_100sp_UNITE <- learn_idtaxa( fasta_for_training = system.file("extdata", "100_sp_UNITE_sh_general_release_dynamic.fasta", package = "MiscMetabar" ), unite = TRUE ) plot(training_100sp_UNITE) ## End(Not run)
Run LEfSe on a phyloseq object
lefser_pq( physeq, bifactor = NULL, modalities = NULL, compute_relativeAb = TRUE, by_clade = FALSE, ... )lefser_pq( physeq, bifactor = NULL, modalities = NULL, compute_relativeAb = TRUE, by_clade = FALSE, ... )
physeq |
(required) a |
bifactor |
(required) The name of a column present in the |
modalities |
(default NULL) A vector of modalities to keep in the analysis. If NULL, all modalities present in bifactor are kept. Note that only two modalities are allowed. |
compute_relativeAb |
(logical, default TRUE) Do we compute relative abundance before running LEfSe? |
by_clade |
(logical, default FALSE) Do we use the lefserClades function (which test for different depth in the taxonomic classification) or the lefser function (taxa-level)? |
... |
Additional arguments passed on to |
It is a wrapper of the lefser::lefser() and lefser::lefserClades() functions.
The result of lefser::lefser() or lefser::lefserClades()
Adrien Taudière
if (requireNamespace("lefser") && requireNamespace("mia")) { res_lefse <- lefser_pq(data_fungi_mini, bifactor = "Height", modalities = c("Low", "High") ) lefser::lefserPlot(res_lefse) }if (requireNamespace("lefser") && requireNamespace("mia")) { res_lefse <- lefser_pq(data_fungi_mini, bifactor = "Height", modalities = c("Low", "High") ) lefser::lefserPlot(res_lefse) }
Useful for targets bioinformatic pipeline.
list_fastq_files( path, paired_end = TRUE, pattern = "fastq", pattern_R1 = "_R1_", pattern_R2 = "_R2_", nb_files = Inf )list_fastq_files( path, paired_end = TRUE, pattern = "fastq", pattern_R1 = "_R1_", pattern_R2 = "_R2_", nb_files = Inf )
path |
path to files (required) |
paired_end |
do you have paired_end files? (default TRUE) |
pattern |
a pattern to filter files (passed on to list.files function). |
pattern_R1 |
a pattern to filter R1 files (default "R1") |
pattern_R2 |
a pattern to filter R2 files (default "R2") |
nb_files |
the number of fastq files to list (default FALSE) |
a list of one (single end) or two (paired end) list of files
files are sorted by names (default behavior of list.files())
Adrien Taudière
list_fastq_files(system.file("extdata", package = "MiscMetabar")) list_fastq_files(system.file("extdata", package = "MiscMetabar"), paired_end = FALSE, pattern_R1 = "" )list_fastq_files(system.file("extdata", package = "MiscMetabar")) list_fastq_files(system.file("extdata", package = "MiscMetabar"), paired_end = FALSE, pattern_R1 = "" )
The original function and documentation was written by Tobias Guldberg Frøslev in the lulu package.
This algorithm lulu consumes an OTU table and a matchlist, and
evaluates cooccurence of 'daughters' (potential analytical artefacts) and
their 'parents' (~= real biological species/OTUs). The algorithm requires an
OTU table (species/site matrix), and a match list. The OTU table can be
made with various r-packages (e.g. DADA2) or
external pipelines (VSEARCH, USEARCH, QIIME, etc.), and the
match-list can be made with external bioinformatic tools like
VSEARCH, USEARCH, BLASTN or another algorithm
for pair-wise sequence matching.
lulu( otu_table, matchlist, minimum_ratio_type = "min", minimum_ratio = 1, minimum_match = 84, minimum_relative_cooccurence = 0.95, progress_bar = TRUE, log_conserved = FALSE )lulu( otu_table, matchlist, minimum_ratio_type = "min", minimum_ratio = 1, minimum_match = 84, minimum_relative_cooccurence = 0.95, progress_bar = TRUE, log_conserved = FALSE )
otu_table |
a data.frame with with an OTU table that has sites/samples as columns and OTUs (unique OTU id's) as rows, and observations as read counts. |
matchlist |
a data.frame containing three columns: (1) OTU id of potential child, (2) OTU id of potential parent, (3) match - % identiti between the sequences of the potential parent and potential child OTUs. NB: The matchlist is the product of a mapping of OTU sequences against each other. This is currently carried out by an external script in e.g. Blastn or VSEARCH, prior to running lulu! |
minimum_ratio_type |
sets whether a potential error must have lower
abundance than the parent in all samples |
minimum_ratio |
sets the minimim abundance ratio between a potential error
and a potential parent to be identified as an error. If the |
minimum_match |
minimum threshold of sequence similarity for considering any OTU as an error of another can be set (default 84%). |
minimum_relative_cooccurence |
minimum co-occurrence rate, i.e. the lower rate of occurrence of the potential error explained by co-occurrence with the potential parent for considering error state. |
progress_bar |
(Logical, default TRUE) print progress during the calculation or not. |
log_conserved |
(Logical, default FALSE) conserved log files writed in the disk |
Please cite the lulu original paper: https://www.nature.com/articles/s41467-017-01312-x
Function lulu returns a list of results based on the input OTU
table and match list.
curated_table - a curated
OTU table with daughters merged with their matching parents.
curated_count - number of curated (parent) OTUs.
curated_otus - ids of the OTUs that were accepted as valid OTUs.
discarded_count - number of discarded (merged with parent) OTUs.
discarded_otus - ids of the OTUs that were identified as
errors (daughters) and merged with respective parents.
runtime - time used by the script.
minimum_match - the id threshold
(minimum match \
by user).
minimum_relative_cooccurence - minimum ratio of
daughter-occurences explained by co-occurence with parent (set by user).
otu_map - information of which daughters were mapped to which
parents.
original_table - original OTU table.
The matchlist is the product of a mapping of OTU sequences against each other. This is
currently carried out by an external script in e.g. BLASTN or VSEARCH, prior to running lulu!
Producing the match list requires a file with all the OTU sequences (centroids) - e.g. OTUcentroids.fasta. The matchlist can be produced by mapping all OTUs against each other with an external algorithm like VSEARCH or BLASTN. In VSEARCH a matchlist can be produced e.g. with the following command: vsearch --usearch_global OTUcentroids.fasta --db OTUcentroids.fasta --strand plus --self --id .80 --iddef 1 --userout matchlist.txt --userfields query+target+id --maxaccepts 0 --query_cov .9 --maxhits 10. In BLASTN a matchlist can be produces e.g. with the following commands. First we produce a blast-database from the fasta file: makeblastdb -in OTUcentroids.fasta -parse_seqids -dbtype nucl, then we match the centroids against that database: blastn -db OTUcentoids.fasta -num_threads 10 -outfmt'6 qseqid sseqid pident' -out matchlist.txt -qcov_hsp_perc .90 -perc_identity .84 -query OTUcentroids.fasta
Tobias Guldberg Frøslev (orcid: 0000-0002-3530-013X), modified by Adrien Taudière
## Not run: # The matchlist is produced by an external tool (VSEARCH or BLASTN). # See the Details section for example commands. otu <- as.data.frame(otu_table(data_fungi_sp_known)) lulu(otu, matchlist) ## End(Not run)## Not run: # The matchlist is produced by an external tool (VSEARCH or BLASTN). # See the Details section for example commands. otu <- as.data.frame(otu_table(data_fungi_sp_known)) lulu(otu, matchlist) ## End(Not run)
physeq
See https://www.nature.com/articles/s41467-017-01312-x for more information on the method.
lulu_pq( physeq, nproc = 1, id = 0.84, vsearchpath = find_vsearch(), verbose = FALSE, clean_pq = FALSE, keep_temporary_files = FALSE, ... )lulu_pq( physeq, nproc = 1, id = 0.84, vsearchpath = find_vsearch(), verbose = FALSE, clean_pq = FALSE, keep_temporary_files = FALSE, ... )
physeq |
(required) a |
nproc |
(default 1) Set to number of cpus/processors to use for the clustering |
id |
(default: 0.84) id for –usearch_global. |
vsearchpath |
(default: vsearch) path to vsearch. |
verbose |
(logical) If true, print some additional messages. |
clean_pq |
(logical) If true, empty samples and empty ASV are discarded before clustering. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files |
... |
Additional arguments passed on to function |
The version of LULU is a fork of Adrien Taudière (https://github.com/adrientaudiere/lulu) from https://github.com/tobiasgf/lulu
a list of for object
"new_physeq": The new phyloseq object (class physeq)
"discrepancy_vector": A vector of discrepancy showing for each taxonomic level the proportion of identic value before and after lulu reclustering. A value of 0.6 stands for 60% of ASV before re-clustering have identical value after re-clustering. In other word, 40% of ASV are assigned to a different taxonomic value. NA value are not counted as discrepancy.
"res_lulu": A list of the result from the lulu function
"merged_ASV": the data.frame used to merged ASV
Tobias Guldberg Frøslev [email protected] & Adrien Taudière [email protected]
LULU : https://github.com/adrientaudiere/lulu forked from https://github.com/tobiasgf/lulu.
VSEARCH can be downloaded from https://github.com/torognes/vsearch.
data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:20], data_fungi_sp_known )) lulu_pq(data_f)data_f <- clean_pq(prune_samples( sample_names(data_fungi_sp_known)[1:20], data_fungi_sp_known )) lulu_pq(data_f)
Computes the residuals from a linear regression of
against
as a depth-robust alpha diversity metric (Mikryukov et al. 2023;
McKnight et al. 2018, doi:10.5061/dryad.tn8qs35). This avoids
discarding data through rarefaction.
mcknight_residuals_pq(physeq, add_to_sam_data = TRUE)mcknight_residuals_pq(physeq, add_to_sam_data = TRUE)
physeq |
(required) a |
add_to_sam_data |
(logical, default |
Either a phyloseq object with an augmented sample_data (default)
or a named numeric vector of residuals.
Adrien Taudière
data_f_res <- mcknight_residuals_pq(data_fungi_mini) head(sample_data(data_f_res)$mcknight_residuals)data_f_res <- mcknight_residuals_pq(data_fungi_mini) head(sample_data(data_f_res)$mcknight_residuals)
Need the installation of kronatools on the computer (installation instruction).
Function merge_krona allows merging multiple html files in one interactive krona file
Note that you need to use the name args in krona() function before merge_krona()
in order to give good name to each krona pie in the output.
merge_krona(files = NULL, output = "mergeKrona.html")merge_krona(files = NULL, output = "mergeKrona.html")
files |
(required) path to html files to merged |
output |
path to the output file |
This function is mainly a wrapper of the work of others. Please cite Krona if you use this function.
A html file
Adrien Taudière
## Not run: data("GlobalPatterns", package = "phyloseq") GA <- subset_taxa(GlobalPatterns, Phylum == "Acidobacteria") krona(GA, "Number.of.sequences.html", name = "Nb_seq_GP_acidobacteria") krona(GA, "Number.of.ASVs.html", nb_seq = FALSE, name = "Nb_asv_GP_acidobacteria") merge_krona(c("Number.of.sequences.html", "Number.of.ASVs.html"), "mergeKrona.html") unlink(c("Number.of.sequences.html", "Number.of.ASVs.html", "mergeKrona.html")) ## End(Not run)## Not run: data("GlobalPatterns", package = "phyloseq") GA <- subset_taxa(GlobalPatterns, Phylum == "Acidobacteria") krona(GA, "Number.of.sequences.html", name = "Nb_seq_GP_acidobacteria") krona(GA, "Number.of.ASVs.html", nb_seq = FALSE, name = "Nb_asv_GP_acidobacteria") merge_krona(c("Number.of.sequences.html", "Number.of.ASVs.html"), "mergeKrona.html") unlink(c("Number.of.sequences.html", "Number.of.ASVs.html", "mergeKrona.html")) ## End(Not run)
Firstly release in the speedyseq R package by Michael R. McLaren.
This function provides an alternative to phyloseq::merge_samples() that
better handles sample variables of different types, especially categorical
sample variables. It combines the samples in x defined by the sample
variable or factor group by summing the abundances in otu_table(x) and
combines sample variables by the summary functions in funs. The default
summary function, unique_or_na(), collapses the values within a group to a
single unique value if it exists and otherwise returns NA. The new (merged)
samples are named by the values in group.
merge_samples2( x, group, fun_otu = sum, funs = list(), reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'phyloseq' merge_samples2( x, group, fun_otu = sum, funs = list(), reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'otu_table' merge_samples2( x, group, fun_otu = sum, reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'sample_data' merge_samples2( x, group, funs = list(), reorder = FALSE, default_fun = unique_or_na )merge_samples2( x, group, fun_otu = sum, funs = list(), reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'phyloseq' merge_samples2( x, group, fun_otu = sum, funs = list(), reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'otu_table' merge_samples2( x, group, fun_otu = sum, reorder = FALSE, default_fun = unique_or_na ) ## S4 method for signature 'sample_data' merge_samples2( x, group, funs = list(), reorder = FALSE, default_fun = unique_or_na )
x |
A |
group |
A sample variable or a vector of length |
fun_otu |
Function for combining abundances in the otu_table; default
is |
funs |
Named list of merge functions for sample variables; default is
|
reorder |
Logical specifying whether to reorder the new (merged) samples by name |
default_fun |
Default functions if funs is not set. Per default
the function unique_or_na is used. See |
A new phyloseq-class, otu_table or sam_data object depending on the class of the x param
Michael R. McLaren (orcid: 0000-0003-1575-473X) modified by Adrien Taudiere
data(enterotype) # Merge samples with the same project and clinical status ps <- enterotype sample_data(ps) <- sample_data(ps) |> transform(Project.ClinicalStatus = Project:ClinicalStatus) sample_data(ps) |> head() ps0 <- merge_samples2(ps, "Project.ClinicalStatus", fun_otu = mean, funs = list(Age = mean) ) sample_data(ps0) |> head()data(enterotype) # Merge samples with the same project and clinical status ps <- enterotype sample_data(ps) <- sample_data(ps) |> transform(Project.ClinicalStatus = Project:ClinicalStatus) sample_data(ps) |> head() ps0 <- merge_samples2(ps, "Project.ClinicalStatus", fun_otu = mean, funs = list(Age = mean) ) sample_data(ps0) |> head()
Firstly release in the speedyseq R package by Michael R. McLaren.
Merge taxa in x into a smaller set of taxa defined by the vector group.
Taxa whose value in group is NA will be dropped. New taxa will be named
according to the most abundant taxon in each group (phyloseq and
otu_table objects) or the first taxon in each group (all other phyloseq
component objects).
If x is a phyloseq object with a phylogenetic tree, then the new taxa will
be ordered as they are in the tree. Otherwise, the taxa order can be
controlled by the reorder argument, which behaves like the reorder
argument in base::rowsum(). reorder = FALSE will keep taxa in
the original order determined by when the member of each group first appears
in taxa_names(x); reorder = TRUE will order new taxa according to their
corresponding value in group.
The tax_adjust argument controls the handling of taxonomic disagreements
within groups. Setting tax_adjust == 0 causes no adjustment; the taxonomy
of the new group is set to the archetype taxon (the most abundant taxon in
each group). Otherwise,
disagreements within a group at a given rank cause the values at lower ranks
to be set to NA. If tax_adjust == 1 (the default), then a rank where all
taxa in the group are already NA is not counted as a disagreement, and lower
ranks may be kept if the taxa agree. This corresponds to the original
phyloseq behavior. If tax_adjust == 2, then these NAs are treated as a
disagreement; all ranks are set to NA after the first disagreement or NA.
merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'phyloseq' merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'otu_table' merge_taxa_vec(x, group, reorder = FALSE, rank_propagation = TRUE) ## S4 method for signature 'taxonomyTable' merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'phylo' merge_taxa_vec(x, group) ## S4 method for signature 'XStringSet' merge_taxa_vec(x, group, reorder = FALSE)merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'phyloseq' merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'otu_table' merge_taxa_vec(x, group, reorder = FALSE, rank_propagation = TRUE) ## S4 method for signature 'taxonomyTable' merge_taxa_vec( x, group, reorder = FALSE, tax_adjust = 1L, rank_propagation = TRUE ) ## S4 method for signature 'phylo' merge_taxa_vec(x, group) ## S4 method for signature 'XStringSet' merge_taxa_vec(x, group, reorder = FALSE)
x |
A phyloseq object or component object |
group |
A vector with one element for each taxon in |
reorder |
Logical specifying whether to reorder the taxa by their
|
tax_adjust |
0: no adjustment; 1: phyloseq-compatible adjustment; 2: conservative adjustment |
rank_propagation |
Logical, default TRUE specifying whether to propagate bad ranks on the right. If FALSE, bad ranks are not propagated to lower ranks. It is mainly useful when working with taxonomic tables with informations beyond strict hierarchical ranks (e.g. Traits, Functional annotations, etc.). |
A new phyloseq-class, otu_table, tax_table, XStringset or sam_data object depending on the class of the x param
Michael R. McLaren (orcid: 0000-0003-1575-473X) modified by Adrien Taudiere
Function in MiscMetabar that use this function: postcluster_pq()
These functions are provided for compatibility with older version of the MiscMetabar package. They may eventually be completely removed.
physeq_graph_test(...)physeq_graph_test(...)
... |
Parameters to be passed on to the modern version of the function |
Depend on the functions.
| graph_test_pq | now a synonym for physeq_graph_test
|
| adonis_pq | now a synonym for adonis_phyloseq
|
| clean_pq | now a synonym for clean_physeq
|
| lulu_pq | now a synonym for lulu_phyloseq
|
| circle_pq | now a synonym for otu_circle
|
| biplot_pq | now a synonym for biplot_physeq
|
| read_pq | now a synonym for read_phyloseq
|
| write_pq | now a synonym for write_phyloseq
|
| sankey_pq | now a synonym for sankey_phyloseq
|
| summary_plot_pq | now a synonym for summary_plot_phyloseq
|
| plot_edgeR_pq | now a synonym for plot_edgeR_phyloseq
|
| plot_deseq2_pq | now a synonym for plot_deseq2_phyloseq
|
| venn_pq | now a synonym for venn_phyloseq
|
| ggvenn_pq | now a synonym for ggVenn_phyloseq
|
| hill_tuckey_pq | now a synonym for hill_tuckey_phyloseq
|
| hill_pq | now a synonym for hill_phyloseq
|
| heat_tree_pq | now a synonym for physeq_heat_tree
|
| compare_pairs_pq | now a synonym for multiple_share_bisamples
|
A wrapper of the MMseqs2
easy-cluster or easy-linclust workflow.
mmseqs2_clustering( physeq = NULL, dna_seq = NULL, nproc = 1, id = 0.97, mmseqs2path = find_mmseqs2(), tax_adjust = 0, rank_propagation = FALSE, mmseqs2_cluster_method = c("easy-cluster", "easy-linclust"), coverage = 0.8, cov_mode = 0, cluster_mode = 0, mmseqs2_args = "", keep_temporary_files = FALSE )mmseqs2_clustering( physeq = NULL, dna_seq = NULL, nproc = 1, id = 0.97, mmseqs2path = find_mmseqs2(), tax_adjust = 0, rank_propagation = FALSE, mmseqs2_cluster_method = c("easy-cluster", "easy-linclust"), coverage = 0.8, cov_mode = 0, cluster_mode = 0, mmseqs2_args = "", keep_temporary_files = FALSE )
physeq |
(required) a |
dna_seq |
You may directly use a character vector of DNA sequences
in place of physeq args. When physeq is set, dna sequences take the
value of |
nproc |
(default: 1) Number of threads. |
id |
(default: 0.97) Minimum sequence identity threshold (0–1). |
mmseqs2path |
Path to the |
tax_adjust |
(Default 0) See the man page
of |
rank_propagation |
(logical, default FALSE). Do we propagate the
NA value from lower taxonomic rank to upper rank?
See the man page of |
mmseqs2_cluster_method |
(default: |
coverage |
(numeric, default: 0.8) Alignment coverage threshold
(0–1), passed to |
cov_mode |
(integer, default: 0) Coverage mode:
|
cluster_mode |
(integer, default: 0) Clustering algorithm:
|
mmseqs2_args |
(character, default: |
keep_temporary_files |
(logical, default: FALSE) Keep intermediate files for debugging? |
This function is mainly a wrapper of the work of others. Please cite MMseqs2.
A new object of class physeq or a data.frame of cluster
membership if dna_seq was used.
Adrien Taudière
MMseqs2 can be downloaded from https://github.com/soedinglab/MMseqs2. More information in the associated publication doi:10.1038/nbt.3988.
postcluster_pq(), vsearch_clustering(), swarm_clustering()
d_mm <- mmseqs2_clustering(data_fungi_mini)d_mm <- mmseqs2_clustering(data_fungi_mini)
This allow to plot all the possible biplot_pq() combination
using one factor.
multi_biplot_pq(physeq, split_by = NULL, pairs = NULL, na_remove = TRUE, ...)multi_biplot_pq(physeq, split_by = NULL, pairs = NULL, na_remove = TRUE, ...)
physeq |
(required) a |
split_by |
(required if pairs is NULL) the name of the factor to make all combination of couples of values |
pairs |
(required if split_by is NULL) the name of the factor in physeq@sam_data' slot
to make plot by pairs of samples. Each level must be present only two times.
Note that if you set pairs, you also must set fact arguments to passed on to |
na_remove |
(logical, default TRUE) if TRUE remove all the samples
with NA in the |
... |
Other parameters passed on to |
a list of ggplot object
Adrien Taudière
data_fungi_abun <- subset_taxa_pq( data_fungi_mini, taxa_sums(data_fungi_mini) > 1000 ) p <- multi_biplot_pq(data_fungi_abun, "Height") lapply(p, print)data_fungi_abun <- subset_taxa_pq( data_fungi_mini, taxa_sums(data_fungi_mini) > 1000 ) p <- multi_biplot_pq(data_fungi_abun, "Height") lapply(p, print)
A wrapper for the indicspecies::multipatt() function in the case of
physeq object.
multipatt_pq( physeq, fact, p_adjust_method = "BH", pval = 0.05, control = permute::how(nperm = 999), ... )multipatt_pq( physeq, fact, p_adjust_method = "BH", pval = 0.05, control = permute::how(nperm = 999), ... )
physeq |
(required) a |
fact |
(required) Name of the factor in |
p_adjust_method |
(chr, default "BH"): the method used to adjust p-value |
pval |
(int, default 0.05): the value to determine the significance of LCBD |
control |
see |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to indicspecies::multipatt() if you
use this function.
A ggplot2 object
Adrien Taudière
if (requireNamespace("indicspecies")) { multipatt_pq(subset_samples(data_fungi_mini, !is.na(Time)), fact = "Time", control = permute::how(nperm = 99) ) multipatt_pq(subset_samples(data_fungi_mini, !is.na(Time)), fact = "Time", max.order = 1, control = permute::how(nperm = 99) ) }if (requireNamespace("indicspecies")) { multipatt_pq(subset_samples(data_fungi_mini, !is.na(Time)), fact = "Time", control = permute::how(nperm = 99) ) multipatt_pq(subset_samples(data_fungi_mini, !is.na(Time)), fact = "Time", max.order = 1, control = permute::how(nperm = 99) ) }
ggplot objects can be passed in ..., or to plotlist (as a list of ggplot objects)
If the layout is something like matrix(c(1,2,3,3), nrow=2, byrow=TRUE), then plot 1 will go in the upper left, 2 will go in the upper right, and 3 will go all the way across the bottom.
multiplot(..., plotlist = NULL, cols = 1, layout = NULL)multiplot(..., plotlist = NULL, cols = 1, layout = NULL)
... |
list of ggplot objects |
plotlist |
list of ggplot objects |
cols |
number of columns |
layout |
A matrix specifying the layout. If present, 'cols' is ignored. |
Nothing. Print the list of ggplot objects
Note that lvl3 need to be nested in lvl2 which need to be nested in lvl1
multitax_bar_pq( physeq, lvl1, lvl2, lvl3, fact = NULL, nb_seq = TRUE, log10trans = TRUE )multitax_bar_pq( physeq, lvl1, lvl2, lvl3, fact = NULL, nb_seq = TRUE, log10trans = TRUE )
physeq |
(required) a |
lvl1 |
(required) Name of the first (higher) taxonomic rank of interest |
lvl2 |
(required) Name of the second (middle) taxonomic rank of interest |
lvl3 |
(required) Name of the first (lower) taxonomic rank of interest |
fact |
Name of the factor to cluster samples by modalities.
Need to be in |
nb_seq |
(logical; default TRUE) If set to FALSE, only the number of ASV is count. Concretely, physeq otu_table is transformed in a binary otu_table (each value different from zero is set to one) |
log10trans |
(logical, default TRUE) If TRUE, the number of sequences (or ASV if nb_seq = FALSE) is log10 transformed. |
A ggplot2 object
Adrien Taudière
if (requireNamespace("ggh4x")) { multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order", "Time") multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order") multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order", nb_seq = FALSE, log10trans = FALSE ) }if (requireNamespace("ggh4x")) { multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order", "Time") multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order") multitax_bar_pq(data_fungi_sp_known, "Phylum", "Class", "Order", nb_seq = FALSE, log10trans = FALSE ) }
physeq
See https://www.nature.com/articles/s41467-017-01312-x for more information on the original method LULU. This is a wrapper of mumu a C++ re-implementation of LULU by Frédéric Mahé
mumu_pq( physeq, nproc = 1, id = 0.84, vsearchpath = find_vsearch(), mumupath = "mumu", lulu_exact = FALSE, verbose = FALSE, clean_pq = TRUE, keep_temporary_files = FALSE, extra_mumu_args = NULL )mumu_pq( physeq, nproc = 1, id = 0.84, vsearchpath = find_vsearch(), mumupath = "mumu", lulu_exact = FALSE, verbose = FALSE, clean_pq = TRUE, keep_temporary_files = FALSE, extra_mumu_args = NULL )
physeq |
(required) a |
nproc |
(default 1) Set to number of cpus/processors to use for the clustering |
id |
(default: 0.84) id for –usearch_global. |
vsearchpath |
(default: vsearch) path to vsearch. |
mumupath |
path to mumu. See mumu for installation instruction |
lulu_exact |
(logical) If true, use the exact same algorithm as LULU corresponding to the –legacy option of mumu. Need mumu version >= v1.1.0 |
verbose |
(logical) If true, print some additional messages. |
clean_pq |
(logical) If true, empty samples and empty ASV are discarded before clustering. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files |
extra_mumu_args |
(character, default: NULL) Additional arguments passed
on to mumu command line. See |
This function is mainly a wrapper of the work of others. Please cite mumu and lulu if you use this function for your work.
a list of for object
"new_physeq": The new phyloseq object (class physeq)
"mumu_results": The log file of the mumu software. Run man mumu into
bash to obtain details about columns' signification.
Frédéric Mahé & Adrien Taudière [email protected]
VSEARCH can be downloaded from https://github.com/torognes/vsearch.
## Not run: ntaxa(data_fungi_sp_known) ntaxa(mumu_pq(data_fungi_sp_known)$new_physeq) ntaxa(mumu_pq(data_fungi_sp_known, extra_mumu_args = "--minimum_match 90")$new_physeq) ## End(Not run)## Not run: ntaxa(data_fungi_sp_known) ntaxa(mumu_pq(data_fungi_sp_known)$new_physeq) ntaxa(mumu_pq(data_fungi_sp_known, extra_mumu_args = "--minimum_match 90")$new_physeq) ## End(Not run)
A more memorable shortcut for theme(legend.position = "none").
no_legend()no_legend()
A ggplot2 object
Adrien Taudière
plot_refseq_pq(data_fungi_mini) plot_refseq_pq(data_fungi_mini) + no_legend()plot_refseq_pq(data_fungi_mini) plot_refseq_pq(data_fungi_mini) + no_legend()
This function implement the method proposed by McKnight et al. 2018 (doi:10.5061/dryad.tn8qs35)
normalize_prop_pq(physeq, base_log = 2, constante = 10000, digits = 4)normalize_prop_pq(physeq, base_log = 2, constante = 10000, digits = 4)
physeq |
(required) a |
base_log |
(integer, default 2) the base for log-transformation. If set to NULL or NA, no log-transformation is compute after normalization. |
constante |
a constante to multiply the otu_table values |
digits |
(default = 4) integer indicating the number of decimal places
to be used (see |
A new phyloseq-class object with otu_table count
normalize and log transformed (if base_log is an integer)
Adrien Taudière
taxa_sums(data_fungi_mini) data_f_norm <- normalize_prop_pq(data_fungi_mini) taxa_sums(data_f_norm) sample_sums(data_f_norm) ggplot(data.frame( "norm" = scale(taxa_sums(data_f_norm)), "raw" = scale(taxa_sums(data_fungi_mini)), "name_otu" = taxa_names(data_f_norm) )) + geom_point(aes(x = raw, y = norm)) data_f_norm <- normalize_prop_pq(taxa_as_columns(data_fungi_mini)) data_f_norm2 <- normalize_prop_pq(data_fungi_mini, base_log = NULL) taxa_sums(data_f_norm2) sample_sums(data_f_norm2)taxa_sums(data_fungi_mini) data_f_norm <- normalize_prop_pq(data_fungi_mini) taxa_sums(data_f_norm) sample_sums(data_f_norm) ggplot(data.frame( "norm" = scale(taxa_sums(data_f_norm)), "raw" = scale(taxa_sums(data_fungi_mini)), "name_otu" = taxa_names(data_f_norm) )) + geom_point(aes(x = raw, y = norm)) data_f_norm <- normalize_prop_pq(taxa_as_columns(data_fungi_mini)) data_f_norm2 <- normalize_prop_pq(data_fungi_mini, base_log = NULL) taxa_sums(data_f_norm2) sample_sums(data_f_norm2)
Mostly for internal use.
perc(x, y = NULL, accuracy = 0, add_symbol = FALSE)perc(x, y = NULL, accuracy = 0, add_symbol = FALSE)
x |
(required) value |
y |
if y is set, compute the division of x by y |
accuracy |
number of digits (number of digits after zero) |
add_symbol |
if set to TRUE add the % symbol to the value |
The percentage value (number or character if add_symbol is set to TRUE)
Adrien Taudière
perc(0.75) perc(3, 10) perc(0.75, add_symbol = TRUE)perc(0.75) perc(3, 10) perc(0.75, add_symbol = TRUE)
Convert phyloseq OTU count data into DGEList for edgeR package
phyloseq_to_edgeR(physeq, group, method = "RLE", remove_na = TRUE, ...)phyloseq_to_edgeR(physeq, group, method = "RLE", remove_na = TRUE, ...)
physeq |
(required) a |
group |
(required) A character vector or factor giving the experimental
group/condition for each sample/library. Alternatively, you may provide
the name of a sample variable. This name should be among the output of
|
method |
The label of the edgeR-implemented normalization
to use.
See
|
remove_na |
(logical) If TRUE, samples with NA values in the group variable will be removed. |
... |
Additional arguments passed on to |
A DGEList object. See edgeR::estimateTagwiseDisp() for more details.
if (requireNamespace("edgeR")) { phyloseq_to_edgeR(data_fungi_mini, group = "Height") }if (requireNamespace("edgeR")) { phyloseq_to_edgeR(data_fungi_mini, group = "Height") }
refseq slot of a phyloseq-class objectInternally used in vsearch_clustering(), swarm_clustering() and
postcluster_pq().
physeq_or_string_to_dna(physeq = NULL, dna_seq = NULL)physeq_or_string_to_dna(physeq = NULL, dna_seq = NULL)
physeq |
(required) a |
dna_seq |
You may directly use a character vector of DNA sequences
in place of physeq args. When physeq is set, dna sequences take the value
of |
An object of class DNAStringSet (see the Biostrings::DNAStringSet()
function)
Adrien Taudière
dna <- physeq_or_string_to_dna(data_fungi) dna sequences_ex <- c( "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG", "TACCTATGTTGCCTTGGCGGCTAAACCTACC", "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG" ) dna2 <- physeq_or_string_to_dna(dna_seq = sequences_ex) dna2dna <- physeq_or_string_to_dna(data_fungi) dna sequences_ex <- c( "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG", "TACCTATGTTGCCTTGGCGGCTAAACCTACC", "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG" ) dna2 <- physeq_or_string_to_dna(dna_seq = sequences_ex) dna2
Graphical representation of ANCOMBC2 result.
plot_ancombc_pq( physeq, ancombc_res, filter_passed = TRUE, filter_diff = TRUE, min_abs_lfc = 0, tax_col = "Genus", tax_label = "Species", add_marginal_vioplot = TRUE, add_label = TRUE, add_hline_cut_lfc = NULL )plot_ancombc_pq( physeq, ancombc_res, filter_passed = TRUE, filter_diff = TRUE, min_abs_lfc = 0, tax_col = "Genus", tax_label = "Species", add_marginal_vioplot = TRUE, add_label = TRUE, add_hline_cut_lfc = NULL )
physeq |
(required) a |
ancombc_res |
(required) the result of the ancombc_pq function For the moment only bimodal factors are possible. |
filter_passed |
(logical, default TRUE) Do we filter using the column passed_ss? The passed_ss value is TRUE if the taxon passed the sensitivity analysis, i.e., adding different pseudo-counts to 0s would not change the results. |
filter_diff |
(logical, default TRUE) Do we filter using the column diff? The diff value is TRUE if the taxon is significant (has q less than alpha) |
min_abs_lfc |
(integer, default 0) Minimum absolute value to filter results based on Log Fold Change. For ex. a value of 1 filter out taxa for which the abundance in a given level of the modalty is not at least the double of the abundance in the other level. |
tax_col |
The taxonomic level (must be present in |
tax_label |
The taxonomic level (must be present in |
add_marginal_vioplot |
(logical, default TRUE) Do we add a marginal vioplot representing all the taxa lfc from ancombc_res. |
add_label |
(logical, default TRUE) Do we add a label? |
add_hline_cut_lfc |
(logical, default NULL) Do we add two horizontal lines when min_abs_lfc is set (different from zero)? |
This function is mainly a wrapper of the work of others.
Please make a reference to ancombc2() if you
use this function.
A ggplot2 object. If add_marginal_vioplot is TRUE, this is a
patchworks of plot made using patchwork::plot_layout().
Adrien Taudière
## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "taxon", verbose = TRUE ) plot_ancombc_pq(data_fungi_mini, res_time, filter_passed = FALSE, tax_label = "Genus", tax_col = "Order" ) plot_ancombc_pq(data_fungi_mini, res_time, tax_col = "Genus") plot_ancombc_pq(data_fungi_mini, res_time, filter_passed = FALSE, filter_diff = FALSE, tax_col = "Family", add_label = FALSE ) } ## End(Not run)## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "taxon", verbose = TRUE ) plot_ancombc_pq(data_fungi_mini, res_time, filter_passed = FALSE, tax_label = "Genus", tax_col = "Order" ) plot_ancombc_pq(data_fungi_mini, res_time, tax_col = "Genus") plot_ancombc_pq(data_fungi_mini, res_time, filter_passed = FALSE, filter_diff = FALSE, tax_col = "Family", add_label = FALSE ) } ## End(Not run)
Basically a wrapper of dada2::seqComplexity()
plot_complexity_pq( physeq, kmer_size = 2, window = NULL, by = 5, bins = 100, aggregate = FALSE, vline_random_kmer = TRUE, ... )plot_complexity_pq( physeq, kmer_size = 2, window = NULL, by = 5, bins = 100, aggregate = FALSE, vline_random_kmer = TRUE, ... )
physeq |
(required) a |
kmer_size |
int (default 2) The size of the kmers (or "oligonucleotides" or "words") to use. |
window |
(int, default NULL) The width in nucleotides of the moving window. If NULL the whole sequence is used. |
by |
(int, default 5) The step size in nucleotides between each moving window tested. |
bins |
(int, default 100). The number of bins to use for the histogram. |
aggregate |
(logical, default FALSE) If TRUE, compute an aggregate quality profile for all samples |
vline_random_kmer |
(logical, default TRUE) If TRUE, add a vertical line at the value for random kmer (equal to 4^kmerSize)) |
... |
Arguments passed on to geom_histogram. |
This function is mainly a wrapper of the work of others.
Please make a reference to dada2::seqComplexity()
A ggplot2 object
Adrien Taudière
dada2::seqComplexity(), dada2::plotComplexity()
plot_complexity_pq(subset_samples(data_fungi_mini, Height == "High"), vline_random_kmer = FALSE ) # plot_complexity_pq(subset_samples(data_fungi_mini, Height == "Low"), # aggregate = FALSE, kmer_size = 4 # ) # plot_complexity_pq(subset_samples(data_fungi, Height == "Low"), # kmer_size = 4)plot_complexity_pq(subset_samples(data_fungi_mini, Height == "High"), vline_random_kmer = FALSE ) # plot_complexity_pq(subset_samples(data_fungi_mini, Height == "Low"), # aggregate = FALSE, kmer_size = 4 # ) # plot_complexity_pq(subset_samples(data_fungi, Height == "Low"), # kmer_size = 4)
Graphical representation of DESeq2 analysis.
plot_deseq2_pq( data, contrast = NULL, tax_table = NULL, pval = 0.05, taxolev = "Genus", select_taxa = NULL, color_tax = "Phylum", tax_depth = NULL, verbose = TRUE, jitter_width = 0.1, ... )plot_deseq2_pq( data, contrast = NULL, tax_table = NULL, pval = 0.05, taxolev = "Genus", select_taxa = NULL, color_tax = "Phylum", tax_depth = NULL, verbose = TRUE, jitter_width = 0.1, ... )
data |
(required) a |
contrast |
(required) contrast specifies what comparison to extract
from the object to build a results table. See |
tax_table |
Required if data is a
|
pval |
(default: 0.05) the significance cutoff used for optimizing the independent filtering. If the adjusted p-value cutoff (FDR) will be a value other than 0.05, pval should be set to that value. |
taxolev |
taxonomic level of interest |
select_taxa |
Either the name of the taxa (in the form of |
color_tax |
taxonomic level used for color or a color vector. |
tax_depth |
Taxonomic depth to test for differential
distribution among contrast. If Null the analysis is done at the OTU
(i.e. Species) level. If not Null, data need to be a column name in
the |
verbose |
whether the function print some information during the computation |
jitter_width |
width for the jitter positioning |
... |
Please cite DESeq2 package if you use chis function.
A ggplot2 plot representing DESeq2 results
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- subset_samples(GP, SampleType %in% c("Soil", "Skin")) if (requireNamespace("DESeq2")) { res <- DESeq2::DESeq(phyloseq_to_deseq2(GP, ~SampleType), test = "Wald", fitType = "local" ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Kingdom" ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Kingdom", pval = 0.7 ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Class", select_taxa = c("522457", "271582") ) }data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") GP <- subset_samples(GP, SampleType %in% c("Soil", "Skin")) if (requireNamespace("DESeq2")) { res <- DESeq2::DESeq(phyloseq_to_deseq2(GP, ~SampleType), test = "Wald", fitType = "local" ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Kingdom" ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Kingdom", pval = 0.7 ) plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Class", select_taxa = c("522457", "271582") ) }
Graphical representation of edgeR result.
plot_edgeR_pq( physeq, contrast = NULL, pval = 0.05, taxolev = "Genus", color_tax = "Phylum", verbose = TRUE, ... )plot_edgeR_pq( physeq, contrast = NULL, pval = 0.05, taxolev = "Genus", color_tax = "Phylum", verbose = TRUE, ... )
physeq |
(required) a |
contrast |
(required) This argument specifies what comparison
to extract from the object to build a results table.
See |
pval |
(default: 0.05) the significance cutoff used for optimizing the independent filtering. If the adjusted p-value cutoff (FDR) will be a value other than 0.05, pval should be set to that value. |
taxolev |
taxonomic level of interest |
color_tax |
taxonomic level used for color assignation |
verbose |
(logical): whether the function print some information during the computation |
... |
A ggplot2 plot representing edgeR results
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GP_archae <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") if (requireNamespace("edgeR")) { plot_edgeR_pq(GP_archae, c("SampleType", "Soil", "Feces"), color_tax = "Kingdom" ) plot_edgeR_pq(GP_archae, c("SampleType", "Soil", "Feces"), taxolev = "Class", color_tax = "Kingdom" ) }data("GlobalPatterns", package = "phyloseq") GP_archae <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") if (requireNamespace("edgeR")) { plot_edgeR_pq(GP_archae, c("SampleType", "Soil", "Feces"), color_tax = "Kingdom" ) plot_edgeR_pq(GP_archae, c("SampleType", "Soil", "Feces"), taxolev = "Class", color_tax = "Kingdom" ) }
add_funguild_info()
Graphical function.
plot_guild_pq(physeq, levels_order = NULL, clean_pq = TRUE, ...)plot_guild_pq(physeq, levels_order = NULL, clean_pq = TRUE, ...)
physeq |
(required) a |
levels_order |
(Default NULL) A character vector to reorder the levels of guild. See examples. |
clean_pq |
(logical, default TRUE): Does the phyloseq
object is cleaned using the |
... |
Other params for be passed on to
|
A ggplot2 object
Adrien Taudière
## Not run: # to avoid bug in CRAN when internet is not available if (requireNamespace("httr")) { d_fung_mini <- add_funguild_info(data_fungi_mini, taxLevels = c( "Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) ) sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE) p <- plot_guild_pq(d_fung_mini) if (requireNamespace("patchwork")) { (plot_guild_pq(subset_samples(d_fung_mini, Height == "Low"), levels_order = p$data$Guild[order(p$data$nb_seq)] ) + theme(legend.position = "none")) + (plot_guild_pq(subset_samples(d_fung_mini, Height == "High"), levels_order = p$data$Guild[order(p$data$nb_seq)] ) + ylab("") + theme(axis.text.y = element_blank())) } } ## End(Not run)## Not run: # to avoid bug in CRAN when internet is not available if (requireNamespace("httr")) { d_fung_mini <- add_funguild_info(data_fungi_mini, taxLevels = c( "Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species" ) ) sort(table(d_fung_mini@tax_table[, "guild"]), decreasing = TRUE) p <- plot_guild_pq(d_fung_mini) if (requireNamespace("patchwork")) { (plot_guild_pq(subset_samples(d_fung_mini, Height == "Low"), levels_order = p$data$Guild[order(p$data$nb_seq)] ) + theme(legend.position = "none")) + (plot_guild_pq(subset_samples(d_fung_mini, Height == "High"), levels_order = p$data$Guild[order(p$data$nb_seq)] ) + ylab("") + theme(axis.text.y = element_blank())) } } ## End(Not run)
A wrapper for the adespatial::beta.div() function in the case of physeq
object.
plot_LCBD_pq( physeq, p_adjust_method = "BH", pval = 0.05, sam_variables = NULL, only_plot_significant = TRUE, ... )plot_LCBD_pq( physeq, p_adjust_method = "BH", pval = 0.05, sam_variables = NULL, only_plot_significant = TRUE, ... )
physeq |
(required) a |
p_adjust_method |
(chr, default "BH"): the method used to adjust p-value |
pval |
(int, default 0.05): the value to determine the significance of LCBD |
sam_variables |
A vector of variable names present in the |
only_plot_significant |
(logical, default TRUE) Do we plot all LCBD values or only the significant ones |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::beta.div() if you
use this function.
A ggplot2 object build with the package patchwork
Adrien Taudière
LCBD_pq, adespatial::beta.div()
if (requireNamespace("adespatial")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = FALSE, pval = 0.2 ) } if (requireNamespace("adespatial")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = TRUE, pval = 0.2 ) if (requireNamespace("patchwork")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = FALSE, sam_variables = c("Time", "Height") ) plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = TRUE, pval = 0.2, sam_variables = c("Time", "Height", "Tree_name") ) & theme( legend.key.size = unit(0.4, "cm"), legend.text = element_text(size = 10), axis.title.x = element_text(size = 6) ) } }if (requireNamespace("adespatial")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = FALSE, pval = 0.2 ) } if (requireNamespace("adespatial")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = TRUE, pval = 0.2 ) if (requireNamespace("patchwork")) { plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = FALSE, sam_variables = c("Time", "Height") ) plot_LCBD_pq(data_fungi_mini, nperm = 100, only_plot_significant = TRUE, pval = 0.2, sam_variables = c("Time", "Height", "Tree_name") ) & theme( legend.key.size = unit(0.4, "cm"), legend.text = element_text(size = 10), axis.title.x = element_text(size = 6) ) } }
phyloseq::mt()
Graphical representation of mt test.
plot_mt(mt = NULL, pval = 0.05, color_tax = "Class", taxa = "Species")plot_mt(mt = NULL, pval = 0.05, color_tax = "Class", taxa = "Species")
mt |
(required) Result of a mt test from the function |
pval |
(default: 0.05) Choose the cut off p-value to plot taxa. |
color_tax |
(default: "Class") A taxonomic level to color the points. |
taxa |
(default: "Species") The taxonomic level you choose for x-positioning. |
a ggplot2 plot of result of a mt test
Adrien Taudière
data_fungi_mini2 <- subset_samples(data_fungi_mini, !is.na(Time)) res <- mt(data_fungi_mini2, "Time", method = "fdr", test = "f", B = 300) plot_mt(res) plot_mt(res, taxa = "Genus", color_tax = "Order")data_fungi_mini2 <- subset_samples(data_fungi_mini, !is.na(Time)) res <- mt(data_fungi_mini2, "Time", method = "fdr", test = "f", B = 300) plot_mt(res) plot_mt(res, taxa = "Genus", color_tax = "Order")
A wrapper of plot_ordination with vegan distance matrix
plot_ordination_pq( physeq, method = "robust.aitchison", ordination_method = "NMDS", ... )plot_ordination_pq( physeq, method = "robust.aitchison", ordination_method = "NMDS", ... )
physeq |
(required) a |
method |
(string, default "robust.aitchison") The distance method to use from vegan::vegdist(). See ?vegan::vegdist for more details. |
ordination_method |
(string, default "NMDS") The ordination method to use in phyloseq::ordinate(). See ?phyloseq::ordinate for more details. |
... |
Additional arguments passed on to phyloseq::plot_ordination() |
Basically a wrapper of phyloseq::plot_ordination() to use aitchison and
robust.aitchison distances from vegan package.
A ggplot2 object
Adrien Taudière
library(patchwork) plot_ordination_pq(data_fungi_mini, method = "robust.aitchison", color = "Height") + plot_ordination_pq(data_fungi_mini, method = "bray", color = "Height")library(patchwork) plot_ordination_pq(data_fungi_mini, method = "robust.aitchison", color = "Height") + plot_ordination_pq(data_fungi_mini, method = "bray", color = "Height")
It is a useful function to check for the absence of unwanted patterns caused for example by Illumina adaptator or bad removal of primers.
If hill_scale is not null, Hill diversity number are used to represent the distribution
of the diversity (equitability) along the sequences.
plot_refseq_extremity_pq( physeq, first_n = 10, last_n = 10, q = c(1, 2), min_width = 0 )plot_refseq_extremity_pq( physeq, first_n = 10, last_n = 10, q = c(1, 2), min_width = 0 )
physeq |
(required) a |
first_n |
(int, default 10) The number of nucleotides to plot the 5' extremity. |
last_n |
(int, default 10) The number of nucleotides to plot the 3' extremity. |
q |
(vector) A vector defining the Hill number wanted. Set to NULL if
you don't want to plot Hill diversity metrics. Hill numbers are more
appropriate in DNA metabarcoding studies when |
min_width |
(int, default 0) Select only the sequences from physeq@refseq with using a
minimum length threshold. If |
A list of 4 objects
p_start and p_last are the ggplot object representing respectively the start and the end of the sequences.
df_start and df_last are the data.frame corresponding to the ggplot object.
Adrien Taudière
data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) library("divent") res1 <- plot_refseq_extremity_pq(data_f, q = 1) names(res1) res1$plot_start res1$plot_last res2 <- plot_refseq_extremity_pq(data_f, first_n = 200, last_n = 100) res2$plot_start res2$plot_last plot_refseq_extremity_pq(data_f, first_n = NULL, last_n = 200, min_width = 200, q = c(3) )$plot_lastdata_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) library("divent") res1 <- plot_refseq_extremity_pq(data_f, q = 1) names(res1) res1$plot_start res1$plot_last res2 <- plot_refseq_extremity_pq(data_f, first_n = 200, last_n = 100) res2$plot_start res2$plot_last plot_refseq_extremity_pq(data_f, first_n = NULL, last_n = 200, min_width = 200, q = c(3) )$plot_last
It is a wrapper of the function plot_refseq_extremity_pq(). See
?plot_refseq_extremity_pq for more examples.
If hill_scale is not null, Hill diversity number are used to represent the distribution
of the diversity (equitability) along the sequences.
plot_refseq_pq( physeq, q = NULL, first_n = min(Biostrings::width(physeq@refseq)), last_n = NULL, min_width = first_n )plot_refseq_pq( physeq, q = NULL, first_n = min(Biostrings::width(physeq@refseq)), last_n = NULL, min_width = first_n )
physeq |
(required) a |
q |
(vector) A vector defining the Hill number wanted. Set to NULL if
you don't want to plot Hill diversity metrics. Hill numbers are more
appropriate in DNA metabarcoding studies when |
first_n |
(int, default 10) The number of nucleotides to plot the 5' extremity. |
last_n |
(int, default 10) The number of nucleotides to plot the 3' extremity. |
min_width |
(int, default 0) Select only the sequences from physeq@refseq with using a
minimum length threshold. If |
A ggplot2 object
Adrien Taudière
plot_refseq_pq(data_fungi_mini) ## Not run: plot_refseq_pq(data_fungi_mini, q = c(2), first_n = 300) ## End(Not run)plot_refseq_pq(data_fungi_mini) ## Not run: plot_refseq_pq(data_fungi_mini, q = c(2), first_n = 300) ## End(Not run)
A wrapper for the adespatial::beta.div() function in the case of physeq
object.
plot_SCBD_pq( physeq, tax_level = "Taxa", tax_col = "Order", min_SCBD = 0.01, ... )plot_SCBD_pq( physeq, tax_level = "Taxa", tax_col = "Order", min_SCBD = 0.01, ... )
physeq |
(required) a |
tax_level |
Taxonomic level to used in y axis |
tax_col |
Taxonomic level to colored points |
min_SCBD |
(default 0.01) the minimum SCBD value to plot the taxa |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::beta.div() if you
use this function.
A ggplot2 object build with the package patchwork
Adrien Taudière
LCBD_pq, adespatial::beta.div()
if (requireNamespace("adespatial")) { plot_SCBD_pq(data_fungi_mini) + geom_text(aes(label = paste(Genus, Species)), hjust = 1, vjust = 2) + xlim(c(0, NA)) } if (requireNamespace("adespatial")) { plot_SCBD_pq(data_fungi_mini, tax_level = "Class", tax_col = "Phylum", min_SCBD = 0 ) + geom_jitter() }if (requireNamespace("adespatial")) { plot_SCBD_pq(data_fungi_mini) + geom_text(aes(label = paste(Genus, Species)), hjust = 1, vjust = 2) + xlim(c(0, NA)) } if (requireNamespace("adespatial")) { plot_SCBD_pq(data_fungi_mini, tax_level = "Class", tax_col = "Phylum", min_SCBD = 0 ) + geom_jitter() }
A diagnostic plot of the number of sequences per samples
plot_seq_ratio_pq(physeq, min_nb_seq = 1000, annotations = TRUE)plot_seq_ratio_pq(physeq, min_nb_seq = 1000, annotations = TRUE)
physeq |
(required) a |
min_nb_seq |
(int) The minimum number of sequences per samples to compare the ratio. |
annotations |
(logical, default TRUE). If FALSE, no annotations are plotted |
The x axis depict the number of sequences per samples and the y axis depicted the ratio of the number of sequences for a given sample divide by the number of sequences of the previous sample when ordered by the number of sequences. A high ratio indicate an important and quick increase of the number of sequence which may indicate that below this ratio, samples are suspicious.
The general idea is to first removed all samples with definitively not enough sequences and then, among the kept samples, find the higher augmentation (ratio) to possibly detect suspicious samples.
A ggplot2 object
Adrien Taudière
plot_seq_ratio_pq(data_fungi_mini, min_nb_seq = 10, annotations = FALSE) plot_seq_ratio_pq(data_fungi, min_nb_seq = 200) data(GlobalPatterns) plot_seq_ratio_pq(GlobalPatterns, min_nb_seq = 100000)plot_seq_ratio_pq(data_fungi_mini, min_nb_seq = 10, annotations = FALSE) plot_seq_ratio_pq(data_fungi, min_nb_seq = 200) data(GlobalPatterns) plot_seq_ratio_pq(GlobalPatterns, min_nb_seq = 100000)
An alternative to phyloseq::plot_bar() function.
plot_tax_pq( physeq, fact = NULL, merge_sample_by = NULL, type = "nb_seq", taxa_fill = "Order", print_values = TRUE, color_border = "lightgrey", linewidth = 0.1, prop_print_value = 0.01, nb_print_value = NULL, add_info = TRUE, na_remove = TRUE, clean_pq = TRUE )plot_tax_pq( physeq, fact = NULL, merge_sample_by = NULL, type = "nb_seq", taxa_fill = "Order", print_values = TRUE, color_border = "lightgrey", linewidth = 0.1, prop_print_value = 0.01, nb_print_value = NULL, add_info = TRUE, na_remove = TRUE, clean_pq = TRUE )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
merge_sample_by |
a vector to determine
which samples to merge using the
|
type |
If "nb_seq" (default), the number of sequences is used in plot. If "nb_taxa", the number of ASV is plotted. If both, return a list of two plots, one for nbSeq and one for ASV. |
taxa_fill |
(default: 'Order') Name of the taxonomic rank of interest |
print_values |
(logical, default TRUE): Do we print some values on plot? |
color_border |
color for the border |
linewidth |
The line width of geom_bar |
prop_print_value |
minimal proportion to print value (default 0.01) |
nb_print_value |
number of higher values to print (replace prop_print_value if both are set). |
add_info |
(logical, default TRUE) Do we add title and subtitle with information about the total number of sequences and the number of samples per modality. |
na_remove |
(logical, default TRUE) if TRUE remove all the samples
with NA in the |
clean_pq |
(logical) If set to TRUE, empty samples are discarded after subsetting ASV |
A ggplot2 object
Adrien Taudière
tax_bar_pq() and multitax_bar_pq()
data(data_fungi_sp_known) plot_tax_pq(data_fungi_sp_known, "Time", merge_sample_by = "Time", taxa_fill = "Class" ) plot_tax_pq(data_fungi_sp_known, "Height", merge_sample_by = "Height", taxa_fill = "Class", na_remove = TRUE, color_border = rgb(0, 0, 0, 0) ) plot_tax_pq(data_fungi_sp_known, "Height", merge_sample_by = "Height", taxa_fill = "Class", na_remove = FALSE, clean_pq = FALSE )data(data_fungi_sp_known) plot_tax_pq(data_fungi_sp_known, "Time", merge_sample_by = "Time", taxa_fill = "Class" ) plot_tax_pq(data_fungi_sp_known, "Height", merge_sample_by = "Height", taxa_fill = "Class", na_remove = TRUE, color_border = rgb(0, 0, 0, 0) ) plot_tax_pq(data_fungi_sp_known, "Height", merge_sample_by = "Height", taxa_fill = "Class", na_remove = FALSE, clean_pq = FALSE )
Partially inspired by phylosmith::tsne_phyloseq() function developed by Schuyler D. Smith.
plot_tsne_pq( physeq, method = "bray", dims = 2, theta = 0, perplexity = 30, fact = NA, ellipse_level = 0.95, plot_dims = c(1, 2), na_remove = TRUE, force_factor = TRUE, ... )plot_tsne_pq( physeq, method = "bray", dims = 2, theta = 0, perplexity = 30, fact = NA, ellipse_level = 0.95, plot_dims = c(1, 2), na_remove = TRUE, force_factor = TRUE, ... )
physeq |
(required) a |
method |
A method to calculate distance using |
dims |
(Int) Output dimensionality (default: 2) |
theta |
(Numeric) Speed/accuracy trade-off (increase for less accuracy), set to 0.0 for exact TSNE (default: 0.0 see details in the man page of |
perplexity |
(Numeric) Perplexity parameter (should not be bigger than 3 * perplexity < nrow(X) - 1, see details in the man page of |
fact |
Name of the column in |
ellipse_level |
The level used in stat_ellipse. Set to NULL to discard ellipse (default = 0.95) |
plot_dims |
A vector of 2 values defining the rank of dimension to plot (default: c(1,2)) |
na_remove |
(logical, default TRUE) Does the samples with NA values in fact are removed? (default: true) |
force_factor |
(logical, default TRUE) Force the fact column to be a factor. |
... |
Additional arguments passed on to |
A ggplot object
Adrien Taudière
if (requireNamespace("Rtsne")) { plot_tsne_pq(data_fungi_mini, fact = "Height", perplexity = 15) } if (requireNamespace("Rtsne")) { plot_tsne_pq(data_fungi_mini, fact = "Time") + geom_label(aes(label = Sample_id, fill = Time)) plot_tsne_pq(data_fungi_mini, fact = "Time", na_remove = FALSE, force_factor = FALSE ) }if (requireNamespace("Rtsne")) { plot_tsne_pq(data_fungi_mini, fact = "Height", perplexity = 15) } if (requireNamespace("Rtsne")) { plot_tsne_pq(data_fungi_mini, fact = "Time") + geom_label(aes(label = Sample_id, fill = Time)) plot_tsne_pq(data_fungi_mini, fact = "Time", na_remove = FALSE, force_factor = FALSE ) }
Graphical representation of the partition of variation obtain with var_par_pq().
plot_var_part_pq( res_varpart, cutoff = 0, digits = 1, digits_quantile = 2, fill_bg = c("seagreen3", "mediumpurple", "blue", "orange"), show_quantiles = FALSE, filter_quantile_zero = TRUE, show_dbrda_signif = FALSE, show_dbrda_signif_pval = 0.05, alpha = 63, id.size = 1.2, min_prop_pval_signif_dbrda = 0.95 )plot_var_part_pq( res_varpart, cutoff = 0, digits = 1, digits_quantile = 2, fill_bg = c("seagreen3", "mediumpurple", "blue", "orange"), show_quantiles = FALSE, filter_quantile_zero = TRUE, show_dbrda_signif = FALSE, show_dbrda_signif_pval = 0.05, alpha = 63, id.size = 1.2, min_prop_pval_signif_dbrda = 0.95 )
res_varpart |
(required) the result of the functions |
cutoff |
The values below cutoff will not be displayed. |
digits |
The number of significant digits. |
digits_quantile |
The number of significant digits for quantile. |
fill_bg |
Fill colours of ellipses. |
show_quantiles |
Do quantiles are printed ? |
filter_quantile_zero |
Do we filter out value with quantile encompassing the zero value? |
show_dbrda_signif |
Do dbrda significance for each component is printed using *? |
show_dbrda_signif_pval |
(float, |
alpha |
(int, |
id.size |
A numerical value giving the character expansion factor for the names of circles or ellipses. |
min_prop_pval_signif_dbrda |
(float, |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::varpart() if you
use this function.
A plot
Adrien Taudière
var_par_rarperm_pq(), var_par_pq()
if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples( data_fungi_mini, !is.na(Time) & !is.na(Height) ) res_var0 <- var_par_pq(data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ) ) plot_var_part_pq(res_var0) } ## Not run: if (requireNamespace("vegan")) { res_var_2 <- var_par_rarperm_pq( data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), nperm = 2, dbrda_computation = TRUE ) plot_var_part_pq(res_var0, digits_quantile = 2, show_dbrda_signif = TRUE) plot_var_part_pq( res_var_2, digits = 5, digits_quantile = 2, cutoff = 0, show_quantiles = TRUE ) } ## End(Not run)if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples( data_fungi_mini, !is.na(Time) & !is.na(Height) ) res_var0 <- var_par_pq(data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ) ) plot_var_part_pq(res_var0) } ## Not run: if (requireNamespace("vegan")) { res_var_2 <- var_par_rarperm_pq( data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), nperm = 2, dbrda_computation = TRUE ) plot_var_part_pq(res_var0, digits_quantile = 2, show_dbrda_signif = TRUE) plot_var_part_pq( res_var_2, digits = 5, digits_quantile = 2, cutoff = 0, show_quantiles = TRUE ) } ## End(Not run)
physeq
or a list of DNA sequencesThis function use the merge_taxa_vec function to merge taxa into clusters.
postcluster_pq( physeq = NULL, dna_seq = NULL, nproc = 1, method = "clusterize", id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE, swarmpath = "swarm", d = 1, swarm_args = "--fastidious", mmseqs2path = find_mmseqs2(), mmseqs2_cluster_method = "easy-cluster", mmseqs2_args = "", method_clusterize = "overlap", ... ) asv2otu( physeq = NULL, dna_seq = NULL, nproc = 1, method = "clusterize", id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE, swarmpath = "swarm", d = 1, swarm_args = "--fastidious", mmseqs2path = find_mmseqs2(), mmseqs2_cluster_method = "easy-cluster", mmseqs2_args = "", method_clusterize = "overlap", ... )postcluster_pq( physeq = NULL, dna_seq = NULL, nproc = 1, method = "clusterize", id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE, swarmpath = "swarm", d = 1, swarm_args = "--fastidious", mmseqs2path = find_mmseqs2(), mmseqs2_cluster_method = "easy-cluster", mmseqs2_args = "", method_clusterize = "overlap", ... ) asv2otu( physeq = NULL, dna_seq = NULL, nproc = 1, method = "clusterize", id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE, swarmpath = "swarm", d = 1, swarm_args = "--fastidious", mmseqs2path = find_mmseqs2(), mmseqs2_cluster_method = "easy-cluster", mmseqs2_args = "", method_clusterize = "overlap", ... )
physeq |
(required) a |
dna_seq |
You may directly use a character vector of DNA sequences
in place of physeq args. When physeq is set, dna sequences take the value of
|
nproc |
(default: 1) Set to number of cpus/processors to use for the clustering |
method |
(default: clusterize) Set the clustering method.
|
id |
(default: 0.97) level of identity to cluster |
vsearchpath |
(default: vsearch) path to vsearch |
tax_adjust |
(Default 0) See the man page
of |
rank_propagation |
(logical, default FALSE). Do we propagate the
NA value from lower taxonomic rank to upper rank?
See the man page of |
vsearch_cluster_method |
(default: "–cluster_size) See other possible
methods in the vsearch manual (e.g.
|
vsearch_args |
(default : "–strand both") a one length character element defining other parameters to passed on to vsearch. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files
|
swarmpath |
(default: swarm) path to swarm |
d |
(default: 1) maximum number of differences allowed between two
amplicons, meaning that two amplicons will be grouped if they have |
swarm_args |
(default : "–fastidious") a one length character element defining other parameters to passed on to swarm See other possible methods in the SWARM pdf manual |
mmseqs2path |
(default: |
mmseqs2_cluster_method |
(default: |
mmseqs2_args |
(default: |
method_clusterize |
(default "overlap") the method for the |
... |
Additional arguments passed on to |
This function use the merge_taxa_vec function to
merge taxa into clusters. By default tax_adjust = 0. See the man page
of merge_taxa_vec().
A new object of class physeq or a list of cluster if dna_seq
args was used.
Adrien Taudière
VSEARCH can be downloaded from https://github.com/torognes/vsearch. More information in the associated publication https://pubmed.ncbi.nlm.nih.gov/27781170.
vsearch_clustering(), swarm_clustering(),
and mmseqs2_clustering()
if (requireNamespace("DECIPHER")) { postcluster_pq(data_fungi_mini) } ## Not run: if (requireNamespace("DECIPHER")) { postcluster_pq(data_fungi_mini, method_clusterize = "longest") if (MiscMetabar::is_swarm_installed()) { d_swarm <- postcluster_pq(data_fungi_mini, method = "swarm") } if (MiscMetabar::is_vsearch_installed()) { d_vs <- postcluster_pq(data_fungi_mini, method = "vsearch") } if (MiscMetabar::is_mmseqs2_installed()) { d_mm <- postcluster_pq(data_fungi_mini, method = "mmseqs2") } } ## End(Not run)if (requireNamespace("DECIPHER")) { postcluster_pq(data_fungi_mini) } ## Not run: if (requireNamespace("DECIPHER")) { postcluster_pq(data_fungi_mini, method_clusterize = "longest") if (MiscMetabar::is_swarm_installed()) { d_swarm <- postcluster_pq(data_fungi_mini, method = "swarm") } if (MiscMetabar::is_vsearch_installed()) { d_vs <- postcluster_pq(data_fungi_mini, method = "vsearch") } if (MiscMetabar::is_mmseqs2_installed()) { d_mm <- postcluster_pq(data_fungi_mini, method = "mmseqs2") } } ## End(Not run)
Wraps divent::profile_hill() to compute a Hill diversity profile across
diversity orders for each sample in a phyloseq object, and returns a
ggplot2 object via ggplot2::autoplot().
profile_hill_pq(physeq, orders = seq(0, 2, 0.1), merge_sample_by = NULL, ...)profile_hill_pq(physeq, orders = seq(0, 2, 0.1), merge_sample_by = NULL, ...)
physeq |
(required) a |
orders |
(numeric vector) Hill diversity orders to compute. Default
|
merge_sample_by |
(character or NULL) If not NULL, merge samples
using |
... |
Additional arguments passed to |
A ggplot2 object.
divent::profile_hill(), hill_curves_pq()
profile_hill_pq( prune_samples(sample_names(data_fungi_mini)[1:5], data_fungi_mini), orders = c(0, 1, 2) )profile_hill_pq( prune_samples(sample_names(data_fungi_mini)[1:5], data_fungi_mini), orders = c(0, 1, 2) )
Hill numbers are the number of equiprobable species giving the same diversity value as the observed distribution.
Note that contrary to hill_pq(), this function does not take into
account for difference in the number of sequences per samples/modalities.
You may use rarefy_by_sample = TRUE if the mean number of sequences per
samples differs among modalities.
psmelt_samples_pq( physeq, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), filter_zero = TRUE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, taxa_ranks = NULL, ... )psmelt_samples_pq( physeq, q = c(0, 1, 2), hill_scales = lifecycle::deprecated(), filter_zero = TRUE, rarefy_by_sample = FALSE, rngseed = FALSE, verbose = TRUE, taxa_ranks = NULL, ... )
physeq |
(required) a |
q |
(numeric vector) Hill diversity orders to compute. If NULL, no
Hill numbers are computed. Default computes Hill number 0 (species
richness), 1 (exponential of Shannon index) and 2 (inverse of Simpson
index). Formerly |
hill_scales |
|
filter_zero |
(logical, default TRUE) Do we filter non present OTU from samples ? For the moment, this has no effect on the result because the dataframe is grouped by samples with abundance summed across OTU. |
rarefy_by_sample |
(logical, default FALSE) If TRUE, rarefy
samples using |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
taxa_ranks |
A vector of taxonomic ranks. For examples c("Family","Genus"). If taxa ranks is not set (default value = NULL), taxonomic information are not present in the resulting tibble. |
... |
Additional arguments passed to |
A tibble with a row for each sample. Columns provide information
from sam_data slot as well as hill numbers, Abundance (nb of sequences),
and Abundance_log10 (log10(1+Abundance)).
Adrien Taudière
Alberdi, A., & Gilbert, M. T. P. (2019). A guide to the application of Hill numbers to DNA-based diversity analyses. Molecular Ecology Resources. doi:10.1111/1755-0998.13014
Calderón-Sanou, I., Münkemüller, T., Boyer, F., Zinger, L., & Thuiller, W. (2019). From environmental DNA sequences to ecological conclusions: How strong is the influence of methodological choices? Journal of Biogeography, 47. doi:10.1111/jbi.13681
psm_tib <- psmelt_samples_pq(data_fungi_mini, hill_scales = c(0, 2, 7)) ## Not run: if (requireNamespace("ggstatsplot")) { ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_0) ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_7) } psm_tib_tax <- psmelt_samples_pq(data_fungi_mini, taxa_ranks = c("Class", "Family")) ggplot(filter(psm_tib_tax, Abundance > 2000), aes(y = Family, x = Abundance, fill = Time)) + geom_bar(stat = "identity") + facet_wrap(~Height) ## End(Not run)psm_tib <- psmelt_samples_pq(data_fungi_mini, hill_scales = c(0, 2, 7)) ## Not run: if (requireNamespace("ggstatsplot")) { ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_0) ggstatsplot::ggbetweenstats(psm_tib, Height, Hill_7) } psm_tib_tax <- psmelt_samples_pq(data_fungi_mini, taxa_ranks = c("Class", "Family")) ggplot(filter(psm_tib_tax, Abundance > 2000), aes(y = Family, x = Abundance, fill = Time)) + geom_bar(stat = "identity") + facet_wrap(~Height) ## End(Not run)
An R-version-robust drop-in replacement for
phyloseq::rarefy_even_depth(), heavily inspired by that function.
rarefy_even_depth_pq( physeq, sample_size = NULL, rngseed = FALSE, replace = TRUE, trimOTUs = TRUE )rarefy_even_depth_pq( physeq, sample_size = NULL, rngseed = FALSE, replace = TRUE, trimOTUs = TRUE )
physeq |
(required) a |
sample_size |
(integer) the sequencing depth to rarefy to. If |
rngseed |
(logical or integer, default |
replace |
(logical, default |
trimOTUs |
(logical, default |
A new phyloseq-class object with a rarefied
otu_table.
Adrien Taudière
phyloseq::rarefy_even_depth(), rarefy_pq()
data_f_rar <- rarefy_even_depth_pq(data_fungi_mini, sample_size = 500) sample_sums(data_f_rar) data_f_rar_notrim <- rarefy_even_depth_pq( data_fungi_mini, sample_size = 500, trimOTUs = FALSE )data_f_rar <- rarefy_even_depth_pq(data_fungi_mini, sample_size = 500) sample_sums(data_f_rar) data_f_rar_notrim <- rarefy_even_depth_pq( data_fungi_mini, sample_size = 500, trimOTUs = FALSE )
Rarefy (subsample to an even depth) a phyloseq object. rarefy_pq() is a
drop-in, R-version-robust replacement for phyloseq::rarefy_even_depth()
that can additionally repeat the rarefaction n times and return the
averaged OTU table, reducing the stochasticity of a single subsampling
pass. With n = 1 (default) the behaviour matches a standard single
rarefaction.
rarefy_pq(physeq, sample_size = NULL, n = 1, seed = 123, replace = FALSE, ...)rarefy_pq(physeq, sample_size = NULL, n = 1, seed = 123, replace = FALSE, ...)
physeq |
(required) a |
sample_size |
(integer) the depth to rarefy to. If |
n |
(integer, default 1) number of rarefaction repetitions to average over. Values > 1 return a non-integer (averaged) OTU table. |
seed |
(integer, default 123) random seed. Set to |
replace |
(logical, default FALSE) sample with replacement? |
... |
Not used. Kept for backward compatibility. |
Rarefaction is performed internally rather than by calling
phyloseq::rarefy_even_depth(), whose replace = FALSE code path relies
on rep_len(x["OTUi"], x["times"]) and errors with invalid 'length.out' value under recent R-devel (see phyloseq issue 1753). For a single
rarefaction (n = 1), the result is identical to
phyloseq::rarefy_even_depth() with trimOTUs = FALSE for the same
seed, sample_size and replace — except in the degenerate case where
a retained sample has a single read, in which phyloseq triggers a
sample() edge-case bug that rarefy_pq() avoids. Empty OTUs are never
trimmed.
A new phyloseq-class object with a
rarefied (or averaged-rarefied) otu_table.
Adrien Taudière
phyloseq::rarefy_even_depth(), transform_pq()
data_f_rar <- rarefy_pq(data_fungi_mini, sample_size = 500, seed = 1) sample_sums(data_f_rar) data_f_rar5 <- rarefy_pq(data_fungi_mini, sample_size = 500, n = 5, seed = 1) sample_sums(data_f_rar5)data_f_rar <- rarefy_pq(data_fungi_mini, sample_size = 500, seed = 1) sample_sums(data_f_rar) data_f_rar5 <- rarefy_pq(data_fungi_mini, sample_size = 500, n = 5, seed = 1) sample_sums(data_f_rar5)
This function randomly draw the same number of samples for each modality of factor.
It is usefull to dissentangle the effect of different number of samples per modality
on diversity. Internally used in accu_plot_balanced_modality().
rarefy_sample_count_by_modality(physeq, fact, rngseed = FALSE, verbose = TRUE)rarefy_sample_count_by_modality(physeq, fact, rngseed = FALSE, verbose = TRUE)
physeq |
(required) a |
fact |
(required) The variable to rarefy. Must be present in
the |
rngseed |
(Optional). A single integer value passed to set.seed, which is used to fix a seed for reproducibly random number generation (in this case, reproducibly random subsampling). If set to FALSE, then no iddling with the RNG seed is performed, and it is up to the user to appropriately call |
verbose |
(logical). If TRUE, print additional information. |
A new phyloseq-class object.
Adrien Taudière
table(data_fungi_mini@sam_data$Height) data_fungi_mini2 <- rarefy_sample_count_by_modality(data_fungi_mini, "Height") table(data_fungi_mini2@sam_data$Height) if (requireNamespace("patchwork")) { ggvenn_pq(data_fungi_mini, "Height") + ggvenn_pq(data_fungi_mini2, "Height") }table(data_fungi_mini@sam_data$Height) data_fungi_mini2 <- rarefy_sample_count_by_modality(data_fungi_mini, "Height") table(data_fungi_mini2@sam_data$Height) if (requireNamespace("patchwork")) { ggvenn_pq(data_fungi_mini, "Height") + ggvenn_pq(data_fungi_mini2, "Height") }
This is the reverse function of write_pq().
read_pq( path = NULL, taxa_are_rows = FALSE, sam_names = NULL, sep_csv = "\t", ... )read_pq( path = NULL, taxa_are_rows = FALSE, sam_names = NULL, sep_csv = "\t", ... )
path |
(required) a path to the folder to read the phyloseq object |
taxa_are_rows |
(default to FALSE) see ?phyloseq for details |
sam_names |
The name of the variable (column) in sam_data.csv to rename
samples. Note that if you use |
sep_csv |
(default tabulation) separator for column |
... |
Additional arguments passed on to |
One to four csv tables (refseq.csv, otu_table.csv, tax_table.csv, sam_data.csv) and if present a phy_tree in Newick format. At least the otu_table.csv need to be present.
Adrien Taudière
write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) read_pq(path = paste0(tempdir(), "/phyloseq")) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) read_pq(path = paste0(tempdir(), "/phyloseq")) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)
Useful for targets bioinformatic pipeline.
rename_samples(phyloseq_component, names_of_samples, taxa_are_rows = FALSE)rename_samples(phyloseq_component, names_of_samples, taxa_are_rows = FALSE)
phyloseq_component |
(required) one of otu_table or sam_data slot of a phyloseq-class object |
names_of_samples |
(required) A vector of samples names |
taxa_are_rows |
(default to FALSE) see ?phyloseq for details |
The otu_table or the sam_data slot with new samples names
Adrien Taudière
otutab <- rename_samples( data_fungi@otu_table, paste0("data_f", sample_names(data_fungi)) ) otutab2 <- rename_samples( clean_pq(data_fungi, force_taxa_as_rows = TRUE )@otu_table, paste0("data_f", sample_names(data_fungi)) ) samda <- rename_samples( data_fungi@sam_data, paste0("data_f", sample_names(data_fungi)) )otutab <- rename_samples( data_fungi@otu_table, paste0("data_f", sample_names(data_fungi)) ) otutab2 <- rename_samples( clean_pq(data_fungi, force_taxa_as_rows = TRUE )@otu_table, paste0("data_f", sample_names(data_fungi)) ) samda <- rename_samples( data_fungi@sam_data, paste0("data_f", sample_names(data_fungi)) )
Useful for targets bioinformatic pipeline.
rename_samples_otu_table(physeq, names_of_samples)rename_samples_otu_table(physeq, names_of_samples)
physeq |
(required) a |
names_of_samples |
(required) The new names of the samples |
the matrix with new colnames (or rownames if taxa_are_rows is true)
Adrien Taudière
rename_samples_otu_table(data_fungi, as.character(seq_along(sample_names(data_fungi))))rename_samples_otu_table(data_fungi, as.character(seq_along(sample_names(data_fungi))))
In stacked bar plots, ggplot2's default discrete palette assigns colors
using level ordered (sometimes alphabetically), which often places perceptually
similar colors next to
each other. This function reassigns the same set of colors to factor
levels so that visually adjacent segments receive maximally different
colors. Both the fill and color scales are updated so that direct
labels (e.g. from label_taxa = TRUE) stay in sync with the bars.
reorder_distinct_colors( p = NULL, alternate_lightness = FALSE, lightness_amount = 0.15, colorblind = FALSE )reorder_distinct_colors( p = NULL, alternate_lightness = FALSE, lightness_amount = 0.15, colorblind = FALSE )
p |
A ggplot object that uses a discrete fill aesthetic. Can be
omitted when using the |
alternate_lightness |
(logical, default FALSE) If TRUE, darken every other level to add a luminance alternation cue on top of hue differences. |
lightness_amount |
(numeric, default 0.15) Intensity of the
lightness alternation (proportion to darken). Only used when
|
colorblind |
(logical, default FALSE) If TRUE, compute perceptual distances under simulated deuteranopia so that the reordering optimizes contrast for colorblind viewers. |
A new ggplot object with ggplot2::scale_fill_manual() and
(if a color scale is present) ggplot2::scale_color_manual()
replacing the original scales. When p is omitted, returns an
object that can be added to a ggplot with +.
Adrien Taudière
p <- tax_bar_pq(data_fungi_mini, taxa = "Class", fact = "Time") reorder_distinct_colors(p) reorder_distinct_colors(p, colorblind = TRUE) p + reorder_distinct_colors(alternate_lightness = TRUE) tax_bar_pq(data_fungi_mini, fact = "Height", taxa = "Order", nb_seq = FALSE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 7, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 8, minimum_value_to_show = 0.05 ) |> reorder_distinct_colors(alternate_lightness = TRUE)p <- tax_bar_pq(data_fungi_mini, taxa = "Class", fact = "Time") reorder_distinct_colors(p) reorder_distinct_colors(p, colorblind = TRUE) p + reorder_distinct_colors(alternate_lightness = TRUE) tax_bar_pq(data_fungi_mini, fact = "Height", taxa = "Order", nb_seq = FALSE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 7, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 8, minimum_value_to_show = 0.05 ) |> reorder_distinct_colors(alternate_lightness = TRUE)
Note that the taxa order in a physeq object with a tree is locked by the order of leaf in the phylogenetic tree.
reorder_taxa_pq(physeq, names_ordered, remove_phy_tree = FALSE)reorder_taxa_pq(physeq, names_ordered, remove_phy_tree = FALSE)
physeq |
(required) a |
names_ordered |
(required) Names of the taxa (must be the same
as taxa in |
remove_phy_tree |
(logical, default FALSE) If TRUE, the phylogenetic tree is removed. It is |
A phyloseq object
Adrien Taudière
data_fungi_ordered_by_genus <- reorder_taxa_pq( data_fungi_mini, taxa_names(data_fungi_mini)[order( as.vector(data_fungi_mini@tax_table[, "Genus"]) )] ) data_fungi_mini_asc_ordered_by_abundance <- reorder_taxa_pq( data_fungi_mini, taxa_names(data_fungi_mini)[order(taxa_sums(data_fungi_mini))] )data_fungi_ordered_by_genus <- reorder_taxa_pq( data_fungi_mini, taxa_names(data_fungi_mini)[order( as.vector(data_fungi_mini@tax_table[, "Genus"]) )] ) data_fungi_mini_asc_ordered_by_abundance <- reorder_taxa_pq( data_fungi_mini, taxa_names(data_fungi_mini)[order(taxa_sums(data_fungi_mini))] )
Internally used in the function assign_blastn() with method="vote"
and assign_vsearch_lca() if top_hits_only is FALSE and vote_algorithm is not NULL.
resolve_vector_ranks( vec, method = c("consensus", "rel_majority", "abs_majority", "preference", "unanimity"), strict = FALSE, second_method = c("consensus", "rel_majority", "abs_majority", "unanimity"), nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = FALSE )resolve_vector_ranks( vec, method = c("consensus", "rel_majority", "abs_majority", "preference", "unanimity"), strict = FALSE, second_method = c("consensus", "rel_majority", "abs_majority", "unanimity"), nb_agree_threshold = 1, preference_index = NULL, collapse_string = "/", replace_collapsed_rank_by_NA = FALSE )
vec |
(required) A vector of (taxonomic) values |
method |
One of "consensus", "rel_majority", "abs_majority", "preference" or "unanimity". See details. |
strict |
(logical, default FALSE). If TRUE, NA are considered as informative in resolving conflict (i.e. NA are taking into account in vote). See details for more informations. |
second_method |
One of "consensus", "rel_majority", "abs_majority", or "unanimity". Only used if method = "preference". See details. |
nb_agree_threshold |
(Int, default 1) The minimum number of times a
value must arise to be selected using vote in method
|
preference_index |
(Int. default NULL). Required if method="preference". Useless for other method. The preference index is the index of the value in vec for which we have a preference. |
collapse_string |
(default '/'). The character to collapse taxonomic names when multiple assignment is done. |
replace_collapsed_rank_by_NA |
(logical, default FALSE). If set to TRUE, all multiple assignments (all taxonomic rank including the 'collapse_string' parameter) are replaced by NA. |
unanimity: Only keep taxonomic value when all methods are agree
By default, the value with NA are not taking into account (strict=FALSE)
If strict , one NA in the row is sufficient to return a NA
consensus: Keep all taxonomic values separated by a '/' (separation can be modify using param collapse_string)
If strict is TRUE, NA are also added to taxonomic vector such as 'Tiger/Cat/NA' instead of 'Tiger/Cat'
abs_majority: Keep the most found taxonomic value if it represent at least half of all taxonomic values.
If strict is TRUE, NA values are also count to determine the majority. For example, a vector of taxonomic rank c("A", "A", "A", "B", NA, NA) will give a value of 'A' if strict is FALSE (default) but a value of NA if strict is TRUE.
nb_agree_threshold: Only keep return value when at least x methods agreed with x is set by parameter nb_agree_threshold. By default, (nb_agree_threshold = 1): a majority of one is enough.
rel_majority: Keep the most found taxonomic value. In case of equality, apply a consensus strategy (collapse values separated by a '/') across the most found taxonomic values.
If strict is TRUE, NA are considered as a rank and can win the relative majority vote. If strict is FALSE (default), NA are removed before ranking the taxonomic values.
nb_agree_threshold: Only keep return value when at least x methods agreed with x is set by parameter nb_agree_threshold. By default, (nb_agree_threshold = 1): a majority of one is enough.
preference: Keep the value from a preferred column.
when the value is NA in the preferred column, apply a second strategy (by default consensus) to the other column (parameter second_method). Note that the parameters strict and nb_agree_threshold are used for the second_method consensus.
a vector of length 1 (one character value)
Adrien Taudière
resolve_vector_ranks(c("A")) resolve_vector_ranks(c("A"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A"), method = "abs_majority") resolve_vector_ranks(c("A"), method = "rel_majority") resolve_vector_ranks(c("A"), method = "rel_majority", nb_agree_threshold = 2 ) resolve_vector_ranks(c("A"), method = "unanimity") resolve_vector_ranks(c("A", "A", "A")) resolve_vector_ranks(c("A", "A", "A"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "A", "A"), method = "abs_majority") resolve_vector_ranks(c("A", "A", "A"), method = "rel_majority") resolve_vector_ranks(c("A", "A", "A"), method = "unanimity") resolve_vector_ranks(c(NA, NA, NA)) resolve_vector_ranks(c(NA, NA, NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c(NA, NA, NA), method = "abs_majority") resolve_vector_ranks(c(NA, NA, NA), method = "rel_majority") resolve_vector_ranks(c(NA, NA, NA), method = "unanimity") resolve_vector_ranks(c("A", "A", NA)) resolve_vector_ranks(c("A", "A", NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "A", NA), method = "rel_majority") resolve_vector_ranks(c("A", "A", NA), method = "abs_majority") resolve_vector_ranks(c("A", "A", NA, NA), method = "abs_majority", strict = FALSE ) resolve_vector_ranks(c("A", "A", NA, NA), method = "abs_majority", strict = TRUE ) resolve_vector_ranks(c("A", "A", NA), method = "unanimity") resolve_vector_ranks(c("A", "A", NA), method = "unanimity", strict = TRUE ) resolve_vector_ranks(c("A", "B", NA)) resolve_vector_ranks(c("A", "B", NA), strict = TRUE) resolve_vector_ranks(c("A", "B", NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "B", NA), method = "abs_majority") resolve_vector_ranks(c("A", "B", NA), method = "rel_majority") resolve_vector_ranks(c("A", "B", NA), method = "rel_majority", strict = TRUE ) resolve_vector_ranks(c("A", "B", NA), method = "rel_majority", nb_agree_threshold = 2 ) resolve_vector_ranks(c("A", "B", NA), method = "unanimity") resolve_vector_ranks(c("A", NA, NA)) resolve_vector_ranks(c("A", NA, NA), method = "rel_majority") resolve_vector_ranks(c("A", NA, NA), method = "unanimity") resolve_vector_ranks(c("A", NA, NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", NA, NA), method = "preference", preference_index = 2 ) resolve_vector_ranks(c("A", NA, "B"), method = "preference", preference_index = 2 ) resolve_vector_ranks(c("A", NA, "B"), method = "preference", preference_index = 2, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "B", "B")) resolve_vector_ranks(c("A", "B", "B"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "B", "B"), method = "abs_majority") resolve_vector_ranks(c("A", "B", "B"), method = "rel_majority") resolve_vector_ranks(c("A", "B", "B"), method = "unanimity") resolve_vector_ranks(c("A", "A", "A", "B", NA, NA)) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), strict = TRUE ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "abs_majority", strict = TRUE ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority", strict = TRUE )resolve_vector_ranks(c("A")) resolve_vector_ranks(c("A"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A"), method = "abs_majority") resolve_vector_ranks(c("A"), method = "rel_majority") resolve_vector_ranks(c("A"), method = "rel_majority", nb_agree_threshold = 2 ) resolve_vector_ranks(c("A"), method = "unanimity") resolve_vector_ranks(c("A", "A", "A")) resolve_vector_ranks(c("A", "A", "A"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "A", "A"), method = "abs_majority") resolve_vector_ranks(c("A", "A", "A"), method = "rel_majority") resolve_vector_ranks(c("A", "A", "A"), method = "unanimity") resolve_vector_ranks(c(NA, NA, NA)) resolve_vector_ranks(c(NA, NA, NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c(NA, NA, NA), method = "abs_majority") resolve_vector_ranks(c(NA, NA, NA), method = "rel_majority") resolve_vector_ranks(c(NA, NA, NA), method = "unanimity") resolve_vector_ranks(c("A", "A", NA)) resolve_vector_ranks(c("A", "A", NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "A", NA), method = "rel_majority") resolve_vector_ranks(c("A", "A", NA), method = "abs_majority") resolve_vector_ranks(c("A", "A", NA, NA), method = "abs_majority", strict = FALSE ) resolve_vector_ranks(c("A", "A", NA, NA), method = "abs_majority", strict = TRUE ) resolve_vector_ranks(c("A", "A", NA), method = "unanimity") resolve_vector_ranks(c("A", "A", NA), method = "unanimity", strict = TRUE ) resolve_vector_ranks(c("A", "B", NA)) resolve_vector_ranks(c("A", "B", NA), strict = TRUE) resolve_vector_ranks(c("A", "B", NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "B", NA), method = "abs_majority") resolve_vector_ranks(c("A", "B", NA), method = "rel_majority") resolve_vector_ranks(c("A", "B", NA), method = "rel_majority", strict = TRUE ) resolve_vector_ranks(c("A", "B", NA), method = "rel_majority", nb_agree_threshold = 2 ) resolve_vector_ranks(c("A", "B", NA), method = "unanimity") resolve_vector_ranks(c("A", NA, NA)) resolve_vector_ranks(c("A", NA, NA), method = "rel_majority") resolve_vector_ranks(c("A", NA, NA), method = "unanimity") resolve_vector_ranks(c("A", NA, NA), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", NA, NA), method = "preference", preference_index = 2 ) resolve_vector_ranks(c("A", NA, "B"), method = "preference", preference_index = 2 ) resolve_vector_ranks(c("A", NA, "B"), method = "preference", preference_index = 2, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "B", "B")) resolve_vector_ranks(c("A", "B", "B"), method = "preference", preference_index = 1 ) resolve_vector_ranks(c("A", "B", "B"), method = "abs_majority") resolve_vector_ranks(c("A", "B", "B"), method = "rel_majority") resolve_vector_ranks(c("A", "B", "B"), method = "unanimity") resolve_vector_ranks(c("A", "A", "A", "B", NA, NA)) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), strict = TRUE ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "abs_majority", strict = TRUE ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority" ) resolve_vector_ranks(c("A", "A", "A", "B", NA, NA, NA), method = "preference", preference_index = 6, second_method = "abs_majority", strict = TRUE )
Graphical representation of distribution of taxa across a factor using ridges.
ridges_pq( physeq, fact, nb_seq = TRUE, log10trans = TRUE, tax_level = "Class", type = "density", ... )ridges_pq( physeq, fact, nb_seq = TRUE, log10trans = TRUE, tax_level = "Class", type = "density", ... )
physeq |
(required) a |
fact |
(required) Name of the factor in |
nb_seq |
(logical; default TRUE) If set to FALSE, only the number of ASV
is count. Concretely, physeq |
log10trans |
(logical, default TRUE) If TRUE, the number of sequences (or ASV if nb_seq = FALSE) is log10 transformed. |
tax_level |
The taxonomic level to fill ridges |
type |
Either "density" (the default) or "ecdf" to plot a
plot a cumulative version using |
... |
Other params passed on to |
A ggplot2 plot with bar representing the number of sequence en each
taxonomic groups
Adrien Taudière
if (requireNamespace("ggridges")) { ridges_pq(data_fungi_mini, "Time", alpha = 0.5, log10trans = FALSE) + xlim(c(0, 1000)) } if (requireNamespace("ggridges")) { ridges_pq(data_fungi_mini, "Time", alpha = 0.5, scale = 0.9) ridges_pq(data_fungi_mini, "Time", alpha = 0.5, scale = 0.9, type = "ecdf") ridges_pq(data_fungi_mini, "Sample_names", log10trans = TRUE) + facet_wrap("~Height") ridges_pq(data_fungi_mini, "Time", jittered_points = TRUE, position = ggridges::position_points_jitter(width = 0.05, height = 0), point_shape = "|", point_size = 3, point_alpha = 1, alpha = 0.7, scale = 0.8 ) }if (requireNamespace("ggridges")) { ridges_pq(data_fungi_mini, "Time", alpha = 0.5, log10trans = FALSE) + xlim(c(0, 1000)) } if (requireNamespace("ggridges")) { ridges_pq(data_fungi_mini, "Time", alpha = 0.5, scale = 0.9) ridges_pq(data_fungi_mini, "Time", alpha = 0.5, scale = 0.9, type = "ecdf") ridges_pq(data_fungi_mini, "Sample_names", log10trans = TRUE) + facet_wrap("~Height") ridges_pq(data_fungi_mini, "Time", jittered_points = TRUE, position = ggridges::position_points_jitter(width = 0.05, height = 0), point_shape = "|", point_size = 3, point_alpha = 1, alpha = 0.7, scale = 0.8 ) }
Graphical representation of distribution of samples across taxa using ridges.
This is the sample-centric counterpart of ridges_pq(): each ridge
represents a taxon (at tax_level) and the x-axis shows the abundance
distribution across samples, optionally colored by a sample factor.
ridges_sam_pq( physeq, fact, nb_seq = TRUE, log10trans = TRUE, tax_level = "Class", type = "density", ... )ridges_sam_pq( physeq, fact, nb_seq = TRUE, log10trans = TRUE, tax_level = "Class", type = "density", ... )
physeq |
(required) a |
fact |
(required) Name of the factor in |
nb_seq |
(logical; default TRUE) If set to FALSE, only the number of
samples is counted. Concretely, physeq |
log10trans |
(logical, default TRUE) If TRUE, the abundance is log10 transformed. |
tax_level |
The taxonomic level used for grouping taxa on the y-axis |
type |
Either "density" (the default) or "ecdf" to plot a
cumulative version using |
... |
Other params passed on to |
A ggplot2 plot with ridges representing the
distribution of samples for each taxon
Adrien Taudière
if (requireNamespace("ggridges")) { ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, log10trans = FALSE, tax_level = "Genus" ) + xlim(c(0, 1000)) } if (requireNamespace("ggridges")) { ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, scale = 0.9) ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, scale = 0.9, type = "ecdf" ) }if (requireNamespace("ggridges")) { ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, log10trans = FALSE, tax_level = "Genus" ) + xlim(c(0, 1000)) } if (requireNamespace("ggridges")) { ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, scale = 0.9) ridges_sam_pq(data_fungi_mini, "Height", alpha = 0.5, scale = 0.9, type = "ecdf" ) }
Make a taxonomic tree using the ASV names of a physeq object and the Open Tree of Life tree.
rotl_pq( physeq, taxonomic_rank = c("Genus", "Species"), context_name = "All life", discard_genus_alone = TRUE, pattern_to_remove_tip = c("ott\\d+|_ott\\d+"), pattern_to_remove_node = c("_ott.*|mrca*") )rotl_pq( physeq, taxonomic_rank = c("Genus", "Species"), context_name = "All life", discard_genus_alone = TRUE, pattern_to_remove_tip = c("ott\\d+|_ott\\d+"), pattern_to_remove_node = c("_ott.*|mrca*") )
physeq |
(required) a |
taxonomic_rank |
(Character) The column(s) present in the @tax_table slot of the phyloseq object. Can be a vector of two columns (e.g. the default c("Genus", "Species")). If only one column is set it need to be format in this way ("Genus species" for ex. "Quercus robur") with a space. |
context_name |
: can bue used to select only a part of the Open Tree
of Life. See |
discard_genus_alone |
(logical) If TRUE (default), genus without information at the species level are discarded. |
pattern_to_remove_tip |
(character regex string) A regex to remove unwanted part of tip names. If set to null, tip names are left intact. |
pattern_to_remove_node |
(character regex string) A regex to remove unwanted part of node names. If set to null, node names are left intact. |
This function is mainly a wrapper of the work of others.
Please make a reference to rotl package if you
use this function.
A plot
Adrien Taudière
## Not run: if (requireNamespace("rotl")) { tr <- rotl_pq(data_fungi_mini, pattern_to_remove_tip = NULL) plot(tr) tr_Asco <- rotl_pq(data_fungi, taxonomic_rank = c("Genus", "Species"), context_name = "Ascomycetes" ) plot(tr_Asco) } ## End(Not run)## Not run: if (requireNamespace("rotl")) { tr <- rotl_pq(data_fungi_mini, pattern_to_remove_tip = NULL) plot(tr) tr_Asco <- rotl_pq(data_fungi, taxonomic_rank = c("Genus", "Species"), context_name = "Ascomycetes" ) plot(tr_Asco) } ## End(Not run)
Useful for targets bioinformatic pipeline.
sam_data_matching_names( path_sam_data, sample_col_name, path_raw_seq, pattern_remove_sam_data = NULL, pattern_remove_fastq_files = NULL, verbose = TRUE, remove_undocumented_fastq_files = FALSE, prefix = NULL, ... )sam_data_matching_names( path_sam_data, sample_col_name, path_raw_seq, pattern_remove_sam_data = NULL, pattern_remove_fastq_files = NULL, verbose = TRUE, remove_undocumented_fastq_files = FALSE, prefix = NULL, ... )
path_sam_data |
(Required) Path to sample data file. |
sample_col_name |
(Required) The name of the column defining sample names in the sample data file. |
path_raw_seq |
(Required) Path to the folder containing fastq files |
pattern_remove_sam_data |
If not null, describe the pattern that will be deleted from sam_data samples names. |
pattern_remove_fastq_files |
If not null, describe the pattern that will be deleted from fastq files names. |
verbose |
(logical, default TRUE) If TRUE, print some additional messages. |
remove_undocumented_fastq_files |
(logical, default FALSE) If set to TRUE fastq files not present in sam_data are removed from your folder. Keep a copy of those files somewhere before. |
prefix |
Add a prefix to new samples names (ex. prefix = "samp") |
... |
Other parameters passed on to |
A list of two objects :
$sam_names_matching is a tibble of corresponding samples names
$sam_data is a sample data files including only matching sample names
Adrien Taudière
## Not run: sam_data_matching_names( path_sam_data = "path/to/sample_data.csv", sample_col_name = "SampleID", path_raw_seq = "path/to/fastq_folder/" ) ## End(Not run)## Not run: sam_data_matching_names( path_sam_data = "path/to/sample_data.csv", sample_col_name = "SampleID", path_raw_seq = "path/to/fastq_folder/" ) ## End(Not run)
Useful for targets bioinformatic pipeline.
sample_data_with_new_names( file_path, names_of_samples, samples_order = NULL, ... )sample_data_with_new_names( file_path, names_of_samples, samples_order = NULL, ... )
file_path |
(required) a path to the sample_data file |
names_of_samples |
(required) a vector of sample names |
samples_order |
Optional numeric vector to sort sample names |
... |
Additional arguments passed on to |
A data.frame from file_path and new names
Adrien Taudière
sam_file <- system.file("extdata", "sam_data.csv", package = "MiscMetabar") sample_data_with_new_names(sam_file, paste0("Samples_", seq(1, 185)))sam_file <- system.file("extdata", "sam_data.csv", package = "MiscMetabar") sample_data_with_new_names(sam_file, paste0("Samples_", seq(1, 185)))
phyloseq-class objectGraphical representation of distribution of taxa across Taxonomy and (optionnaly a factor).
sankey_pq( physeq = NULL, fact = NULL, taxa = 1:4, add_nb_seq = FALSE, min_prop_tax = 0, tax2remove = NULL, units = NULL, symbol2sub = c("\\.", "-"), ... )sankey_pq( physeq = NULL, fact = NULL, taxa = 1:4, add_nb_seq = FALSE, min_prop_tax = 0, tax2remove = NULL, units = NULL, symbol2sub = c("\\.", "-"), ... )
physeq |
(required) a |
fact |
Name of the factor to cluster samples by modalities.
Need to be in |
taxa |
a vector of taxonomic rank to plot |
add_nb_seq |
Represent the number of sequences or the number of OTUs (add_nb_seq = FALSE). Note that plotting the number of sequences is slower. |
min_prop_tax |
(default: 0) The minimum proportion for taxa to be plotted. EXPERIMENTAL. For the moment each links below the min.prop. tax is discard from the sankey network resulting in sometimes weird plot. |
tax2remove |
a vector of taxonomic groups to remove from the analysis
(e.g. |
units |
character string describing physical units (if any) for Value |
symbol2sub |
(default: c('\.', '-')) vector of symbol to delete in the taxonomy |
... |
Additional arguments passed on to
|
A sankeyNetwork plot representing the
taxonomic distribution of OTUs or sequences. If fact is set,
represent the distribution of the last taxonomic level in the modalities
of fact
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") if (requireNamespace("networkD3")) { sankey_pq(GP, fact = "SampleType") } if (requireNamespace("networkD3")) { sankey_pq(GP, taxa = 1:4, min_prop_tax = 0.01) sankey_pq(GP, taxa = 1:4, min_prop_tax = 0.01, add_nb_seq = TRUE) }data("GlobalPatterns", package = "phyloseq") GP <- subset_taxa(GlobalPatterns, GlobalPatterns@tax_table[, 1] == "Archaea") if (requireNamespace("networkD3")) { sankey_pq(GP, fact = "SampleType") } if (requireNamespace("networkD3")) { sankey_pq(GP, taxa = 1:4, min_prop_tax = 0.01) sankey_pq(GP, taxa = 1:4, min_prop_tax = 0.01, add_nb_seq = TRUE) }
A wrapper of write_pq to save in all three possible formats
save_pq(physeq, path = NULL, ...)save_pq(physeq, path = NULL, ...)
physeq |
(required) a |
path |
a path to the folder to save the phyloseq object |
... |
Additional arguments passed on to |
Write :
4 separate tables
1 table version
1 RData file
Build a folder (in path) with four csv tables (refseq.csv, otu_table.csv, tax_table.csv, sam_data.csv) + one
table with all tables together + a rdata file (physeq.RData) that can be loaded using
base::load() function + if present a phylogenetic tree in Newick format (phy_tree.txt)
Adrien Taudière
save_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)save_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)
Search for exact matching of sequences using complement, reverse and reverse-complement. It is useful to check for primers issues after cutadapt step.
search_exact_seq_pq(physeq, seq2search)search_exact_seq_pq(physeq, seq2search)
physeq |
(required) a |
seq2search |
A DNAStringSet object of sequences to search for. |
A list of data-frames for each input sequences with the name, the sequences and the number of occurrences of the original sequence, the complement sequence, the reverse sequence and the reverse-complement sequence.
Adrien Taudière
data("data_fungi") search_primers <- search_exact_seq_pq(data_fungi, seq2search = Biostrings::DNAStringSet(c("TTGAACGCACATTGCGCC", "ATCCCTACCTGATCCGAG")) )data("data_fungi") search_primers <- search_exact_seq_pq(data_fungi, seq2search = Biostrings::DNAStringSet(c("TTGAACGCACATTGCGCC", "ATCCCTACCTGATCCGAG")) )
Mostly for internal used, for example in function track_wkflow_samples().
select_one_sample(physeq, sam_name, silent = FALSE)select_one_sample(physeq, sam_name, silent = FALSE)
physeq |
(required) a |
sam_name |
(required) The sample name to select |
silent |
(logical) If true, no message are printing. |
A new phyloseq-class object with one sample
Adrien Taudière
A8_005 <- select_one_sample(data_fungi, "A8-005_S4_MERGED.fastq.gz") A8_005A8_005 <- select_one_sample(data_fungi, "A8-005_S4_MERGED.fastq.gz") A8_005
Select (a subset of) taxa; if x allows taxa to be reordered, then taxa are
given in the specified order.
select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'sample_data,character' select_taxa(x, taxa) ## S4 method for signature 'otu_table,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'taxonomyTable,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'XStringSet,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'phylo,character' select_taxa(x, taxa) ## S4 method for signature 'phyloseq,character' select_taxa(x, taxa, reorder = TRUE)select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'sample_data,character' select_taxa(x, taxa) ## S4 method for signature 'otu_table,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'taxonomyTable,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'XStringSet,character' select_taxa(x, taxa, reorder = TRUE) ## S4 method for signature 'phylo,character' select_taxa(x, taxa) ## S4 method for signature 'phyloseq,character' select_taxa(x, taxa, reorder = TRUE)
x |
A phyloseq object or phyloseq component object |
taxa |
Character vector of taxa to select, in requested order |
reorder |
Logical specifying whether to use the order in |
This is a simple selector function that is like prune_taxa(taxa, x) when
taxa is a character vector but always gives the taxa in the order taxa
if possible (that is, except for phy_tree's and phyloseq objects that
contain phy_tree's).
An object of the same class as x, subsetted to the specified taxa.
Michael R. McLaren (orcid: 0000-0003-1575-473X)
Internally used in plot_ancombc_pq().
signif_ancombc( ancombc_res, filter_passed = TRUE, filter_diff = TRUE, min_abs_lfc = 0 )signif_ancombc( ancombc_res, filter_passed = TRUE, filter_diff = TRUE, min_abs_lfc = 0 )
ancombc_res |
(required) the result of the ancombc_pq function For the moment only bimodal factors are possible. |
filter_passed |
(logical, default TRUE) Do we filter using the column passed_ss? The passed_ss value is TRUE if the taxon passed the sensitivity analysis, i.e., adding different pseudo-counts to 0s would not change the results. |
filter_diff |
(logical, default TRUE) Do we filter using the column diff? The diff value is TRUE if the taxon is significant (has q less than alpha) |
min_abs_lfc |
(integer, default0) Minimum absolute value to filter results based on Log Fold Change. For ex. a value of 1 filter out taxa for which the abundance in a given level of the modality is not at least the double of the abundance in the other level. |
This function is mainly a wrapper of the work of others.
Please make a reference to ancombc2() if you
use this function.
A data.frame with the same number of columns than the ancombc_res
param but with less (or equal) numbers of rows
ancombc_pq(), plot_ancombc_pq()
## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "taxon", verbose = TRUE ) signif_ancombc(res_time) } ## End(Not run)## Not run: if (requireNamespace("mia")) { data_fungi_mini@tax_table <- phyloseq::tax_table(cbind( data_fungi_mini@tax_table, "taxon" = taxa_names(data_fungi_mini) )) res_time <- ancombc_pq( data_fungi_mini, fact = "Time", levels_fact = c("0", "15"), tax_level = "taxon", verbose = TRUE ) signif_ancombc(res_time) } ## End(Not run)
Internally used in clean_pq()
simplify_taxo( physeq, pattern_to_remove = c(".__", ".*:"), remove_space = TRUE, remove_NA = FALSE )simplify_taxo( physeq, pattern_to_remove = c(".__", ".*:"), remove_space = TRUE, remove_NA = FALSE )
physeq |
(required) a |
pattern_to_remove |
(a vector of character) the pattern to remove using |
remove_space |
(logical; default TRUE): do we remove space? |
remove_NA |
(logical; default FALSE): do we remove NA (in majuscule)? |
A phyloseq-class object with simplified taxonomy
Adrien Taudière
d_fm <- data_fungi_mini d_fm@tax_table[, "Species"] <- paste0(rep( c("s__", "s:"), ntaxa(d_fm) / 2 ), d_fm@tax_table[, "Species"]) # First column is the new vector of Species, # second column is the column before simplification cbind( simplify_taxo(d_fm)@tax_table[, "Species"], d_fm@tax_table[, "Species"] ) cbind( simplify_taxo(d_fm, remove_NA = TRUE)@tax_table[, "Species"], d_fm@tax_table[, "Species"] )d_fm <- data_fungi_mini d_fm@tax_table[, "Species"] <- paste0(rep( c("s__", "s:"), ntaxa(d_fm) / 2 ), d_fm@tax_table[, "Species"]) # First column is the new vector of Species, # second column is the column before simplification cbind( simplify_taxo(d_fm)@tax_table[, "Species"], d_fm@tax_table[, "Species"] ) cbind( simplify_taxo(d_fm, remove_NA = TRUE)@tax_table[, "Species"], d_fm@tax_table[, "Species"] )
A wraper of SRS::SRScurve() function.
SRS_curve_pq(physeq, clean_pq = FALSE, ...)SRS_curve_pq(physeq, clean_pq = FALSE, ...)
physeq |
(required) a |
clean_pq |
(logical): Does the phyloseq
object is cleaned using the |
... |
Additional arguments passed on to |
A plot
if (requireNamespace("SRS")) { SRS_curve_pq(data_fungi_mini, max.sample.size = 200, rarefy.comparison = TRUE, rarefy.repeats = 3 ) } if (requireNamespace("SRS")) { SRS_curve_pq(data_fungi_mini, max.sample.size = 500, metric = "shannon") }if (requireNamespace("SRS")) { SRS_curve_pq(data_fungi_mini, max.sample.size = 200, rarefy.comparison = TRUE, rarefy.repeats = 3 ) } if (requireNamespace("SRS")) { SRS_curve_pq(data_fungi_mini, max.sample.size = 500, metric = "shannon") }
Wrapper around SRS::SRS() (Heidrich et al. 2021,
doi:10.7717/peerj.9593) which scales all samples to a common count
Cmin while preserving the rank order of OTU abundances.
srs_pq(physeq, Cmin = NULL, ...)srs_pq(physeq, Cmin = NULL, ...)
physeq |
(required) a |
Cmin |
(integer) the common scaling depth. Defaults to
|
... |
Additional arguments passed on to |
A new phyloseq-class object with the SRS
normalised otu_table.
Adrien Taudière
data_f_srs <- srs_pq(data_fungi_mini) sample_sums(data_f_srs)data_f_srs <- srs_pq(data_fungi_mini) sample_sums(data_f_srs)
Useful to test a pipeline on small fastq files.
subsample_fastq(fastq_files, folder_output = "subsample", nb_seq = 1000)subsample_fastq(fastq_files, folder_output = "subsample", nb_seq = 1000)
fastq_files |
The path to one fastq file or a list of fastq files (see examples) |
folder_output |
The path to a folder for output files |
nb_seq |
(int; default 1000) : Number of sequences kept (every sequence spread across 4 lines) |
Nothing, create subsampled fastq files in a folder
Adrien Taudière
ex_file <- system.file("extdata", "ex_R1_001.fastq.gz", package = "MiscMetabar", mustWork = TRUE ) subsample_fastq(ex_file, paste0(tempdir(), "/output_fastq")) subsample_fastq(list_fastq_files(system.file("extdata", package = "MiscMetabar")), paste0(tempdir(), "/output_fastq"), n = 10 ) unlink(paste0(tempdir(), "/output_fastq"), recursive = TRUE)ex_file <- system.file("extdata", "ex_R1_001.fastq.gz", package = "MiscMetabar", mustWork = TRUE ) subsample_fastq(ex_file, paste0(tempdir(), "/output_fastq")) subsample_fastq(list_fastq_files(system.file("extdata", package = "MiscMetabar")), paste0(tempdir(), "/output_fastq"), n = 10 ) unlink(paste0(tempdir(), "/output_fastq"), recursive = TRUE)
The main objective of this function is to complete the
phyloseq::subset_samples() function by propose a more easy
(but more prone to error) way of subset_samples.
It replace the subsetting expression which used the name of the variable
in the sam_data by a boolean vector.
Warnings: you must verify the result of this function as the
boolean condition must match the order of samples in the sam_data
slot.
This function is robust when you use the sam_data slot of the phyloseq object used in physeq (see examples)
subset_samples_pq(physeq, condition)subset_samples_pq(physeq, condition)
physeq |
(required) a |
condition |
A boolean vector to subset samples. Length must fit the number of samples |
a new phyloseq object
Adrien Taudière
cond_samp <- grepl("A1", data_fungi@sam_data[["Sample_names"]]) subset_samples_pq(data_fungi, cond_samp) subset_samples_pq(data_fungi, data_fungi@sam_data[["Height"]] == "Low")cond_samp <- grepl("A1", data_fungi@sam_data[["Sample_names"]]) subset_samples_pq(data_fungi, cond_samp) subset_samples_pq(data_fungi, data_fungi@sam_data[["Height"]] == "Low")
The main objective of this function is to complete the
phyloseq::subset_taxa() function by propose a more easy way of
subset_taxa using a named boolean vector. Names must match taxa_names.
subset_taxa_pq( physeq, condition, verbose = TRUE, clean_pq = TRUE, taxa_names_from_physeq = FALSE )subset_taxa_pq( physeq, condition, verbose = TRUE, clean_pq = TRUE, taxa_names_from_physeq = FALSE )
physeq |
(required) a |
condition |
A named boolean vector to subset taxa. Length must fit
the number of taxa and names must match taxa_names. Can also be a
condition using a column of the tax_table slot (see examples). If
the order of condition is the same as taxa_names(physeq),
you can use the parameter |
verbose |
(logical) Informations are printed |
clean_pq |
(logical) If set to TRUE, empty samples are discarded after subsetting ASV |
taxa_names_from_physeq |
(logical) If set to TRUE, rename the
condition vector using taxa_names(physeq). Carefully check the result
of this function if you use this parameter. No effect if the condition
is of class |
a new phyloseq object
Adrien Taudière
subset_taxa_pq(data_fungi, data_fungi@tax_table[, "Phylum"] == "Ascomycota") subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 100) cond_taxa <- grepl("Endophyte", data_fungi@tax_table[, "Guild"]) names(cond_taxa) <- taxa_names(data_fungi) subset_taxa_pq(data_fungi, cond_taxa) subset_taxa_pq(data_fungi, grepl("mycor", data_fungi@tax_table[, "Guild"]), taxa_names_from_physeq = TRUE )subset_taxa_pq(data_fungi, data_fungi@tax_table[, "Phylum"] == "Ascomycota") subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 100) cond_taxa <- grepl("Endophyte", data_fungi@tax_table[, "Guild"]) names(cond_taxa) <- taxa_names(data_fungi) subset_taxa_pq(data_fungi, cond_taxa) subset_taxa_pq(data_fungi, grepl("mycor", data_fungi@tax_table[, "Guild"]), taxa_names_from_physeq = TRUE )
There is 3 main methods : discard taxa (i) using a control taxa (e.g. truffle root tips), (ii) using a mixture models to detect bimodality in pseudo-abundance distribution or (iii) using a minimum difference threshold pseudo-abundance. Each cutoff is defined at the sample level.
subset_taxa_tax_control( physeq, taxa_distri, method = "mean", min_diff_for_cutoff = NULL )subset_taxa_tax_control( physeq, taxa_distri, method = "mean", min_diff_for_cutoff = NULL )
physeq |
(required) a |
taxa_distri |
(required) a vector of length equal to the number of samples with the number of sequences per sample for the taxa control |
method |
(default: "mean") a method to calculate the cut-off value. There are 6 available methods:
|
min_diff_for_cutoff |
(int) argument for method |
A new phyloseq-class object.
Adrien Taudière
subset_taxa_tax_control(data_fungi, as.numeric(data_fungi@otu_table[, 300]), min_diff_for_cutoff = 2 )subset_taxa_tax_control(data_fungi, as.numeric(data_fungi@otu_table[, 300]), min_diff_for_cutoff = 2 )
phyloseq-class object using a plot.Graphical representation of a phyloseq object.
summary_plot_pq( physeq, add_info = TRUE, min_seq_samples = 500, clean_pq = TRUE, text_size = 1, text_size_info = 1 )summary_plot_pq( physeq, add_info = TRUE, min_seq_samples = 500, clean_pq = TRUE, text_size = 1, text_size_info = 1 )
physeq |
(required) a |
add_info |
Does the bottom down corner contain extra informations? |
min_seq_samples |
(int): Used only when add_info is set to true to print the number of samples with less sequences than this number. |
clean_pq |
(logical): Does the phyloseq
object is cleaned using the |
text_size |
(Num, default 1) A size factor to expand or minimize text size. |
text_size_info |
(Num, default 1) A size factor to expand or minimize text size for extra informations. |
A ggplot2 object
summary_plot_pq(data_fungi_mini) summary_plot_pq(data_fungi_mini, add_info = FALSE) + scale_fill_viridis_d() if (requireNamespace("patchwork")) { (summary_plot_pq(data_fungi, text_size = 0.5, text_size_info = 0.6) + summary_plot_pq(data_fungi_mini, text_size = 0.5, text_size_info = 0.6)) / (summary_plot_pq(data_fungi_sp_known, text_size = 0.5, text_size_info = 0.6) + summary_plot_pq(subset_taxa(data_fungi_sp_known, Phylum == "Ascomycota"), text_size = 0.5, text_size_info = 0.6 )) }summary_plot_pq(data_fungi_mini) summary_plot_pq(data_fungi_mini, add_info = FALSE) + scale_fill_viridis_d() if (requireNamespace("patchwork")) { (summary_plot_pq(data_fungi, text_size = 0.5, text_size_info = 0.6) + summary_plot_pq(data_fungi_mini, text_size = 0.5, text_size_info = 0.6)) / (summary_plot_pq(data_fungi_sp_known, text_size = 0.5, text_size_info = 0.6) + summary_plot_pq(subset_taxa(data_fungi_sp_known, Phylum == "Ascomycota"), text_size = 0.5, text_size_info = 0.6 )) }
physeq
or cluster a list of DNA sequences using SWARMA wrapper of SWARM software.
swarm_clustering( physeq = NULL, dna_seq = NULL, d = 1, swarmpath = "swarm", vsearch_path = find_vsearch(), nproc = 1, fastidious = TRUE, swarm_args = "", tax_adjust = 0, rank_propagation = FALSE, return_swarm_df = FALSE, keep_temporary_files = FALSE )swarm_clustering( physeq = NULL, dna_seq = NULL, d = 1, swarmpath = "swarm", vsearch_path = find_vsearch(), nproc = 1, fastidious = TRUE, swarm_args = "", tax_adjust = 0, rank_propagation = FALSE, return_swarm_df = FALSE, keep_temporary_files = FALSE )
physeq |
(required) a |
dna_seq |
NOT WORKING FOR THE MOMENT
You may directly use a character vector of DNA sequences
in place of physeq args. When physeq is set, dna sequences take the value of
|
d |
(default: 1) maximum number of differences allowed between two
amplicons, meaning that two amplicons will be grouped if they have |
swarmpath |
(default: swarm) path to swarm |
vsearch_path |
(default: vsearch) path to vsearch, used only if physeq is NULL and dna_seq is provided. |
nproc |
(default: 1) Set to number of cpus/processors to use for the clustering |
fastidious |
(logical, default TRUE), perform a second clustering pass to reduce the number of small clusters (recommended option by swarm authors). Not that if d is different from 1, fastidious is automatically set to FALSE. |
swarm_args |
a one length character element defining other parameters to passed on to swarm (e.g. "–mismatch-penalty 4"). See other possible methods in the SWARM pdf manual |
tax_adjust |
(Default 0) See the man page
of |
rank_propagation |
(logical, default FALSE). Do we propagate the
NA value from lower taxonomic rank to upper rank?
See the man page of |
return_swarm_df |
(logical, default FALSE) Do we return the swarm dataframe instead of the phyloseq object ? Default FALSE return a phyloseq object if physeq is provided. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files ?
|
This function use the merge_taxa_vec function to
merge taxa into clusters. By default tax_adjust = 0 and rank_propagation = FALSE.
See the man page of merge_taxa_vec().
This function is mainly a wrapper of the work of others. Please cite SWARM.
A new object of class physeq or a list of cluster if dna_seq
args was used or if return_swarm_df was set to TRUE.
SWARM can be downloaded from https://github.com/torognes/swarm/.
SWARM can be downloaded from https://github.com/torognes/swarm. More information in the associated publications doi:10.1093/bioinformatics/btab493 and doi:10.7717/peerj.593
postcluster_pq(), vsearch_clustering()
summary_plot_pq(data_fungi) system2("swarm", "-h") data_fungi_swarm <- swarm_clustering(data_fungi) summary_plot_pq(data_fungi_swarm) sequences_ex <- c( "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG", "TACCTATGTTGCCTTGGCGGCTAAACCTACC", "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG" ) sequences_ex_swarm <- swarm_clustering( dna_seq = sequences_ex )summary_plot_pq(data_fungi) system2("swarm", "-h") data_fungi_swarm <- swarm_clustering(data_fungi) summary_plot_pq(data_fungi_swarm) sequences_ex <- c( "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT", "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG", "TACCTATGTTGCCTTGGCGGCTAAACCTACC", "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG", "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG" ) sequences_ex_swarm <- swarm_clustering( dna_seq = sequences_ex )
Graphical representation of distribution of taxonomy, optionnaly across a factor.
tax_bar_pq( physeq, fact = "Sample", taxa = "Order", percent_bar = FALSE, nb_seq = TRUE, add_ribbon = FALSE, ribbon_alpha = 0.3, label_taxa = FALSE, void_theme = TRUE, show_values = FALSE, minimum_value_to_show = 0, label_size = 3.2, value_size = 3, top_label_size = 3.2, bar_width = NULL, bar_internal_color = NA, linewidth_bar_internal = ifelse(is.na(bar_internal_color), 0, 0.5), show_n_samples = TRUE, n_sample_text_size = 3 )tax_bar_pq( physeq, fact = "Sample", taxa = "Order", percent_bar = FALSE, nb_seq = TRUE, add_ribbon = FALSE, ribbon_alpha = 0.3, label_taxa = FALSE, void_theme = TRUE, show_values = FALSE, minimum_value_to_show = 0, label_size = 3.2, value_size = 3, top_label_size = 3.2, bar_width = NULL, bar_internal_color = NA, linewidth_bar_internal = ifelse(is.na(bar_internal_color), 0, 0.5), show_n_samples = TRUE, n_sample_text_size = 3 )
physeq |
(required) a |
fact |
Name of the factor to cluster samples by modalities.
Need to be in |
taxa |
(default: 'Order') Name of the taxonomic rank of interest |
percent_bar |
(default FALSE) If TRUE, the stacked bar fill all
the space between 0 and 1. It just set position = "fill" in the
|
nb_seq |
(logical; default TRUE) If set to FALSE, only the number of ASV is count. Concretely, physeq otu_table is transformed in a binary otu_table (each value different from zero is set to one) |
add_ribbon |
(logical; default FALSE) If TRUE and |
ribbon_alpha |
(numeric; default 0.3) Transparency of the ribbons. |
label_taxa |
(logical; default FALSE) If TRUE, replace the legend with direct labels on the right side of the last bar. Taxa that appear in the first bar but are absent from the last bar are additionally labelled on the left side of the first bar. Segments are drawn to resolve overlapping labels. |
void_theme |
(logical; default TRUE) If TRUE, use
|
show_values |
(logical; default FALSE) If TRUE, display
abundance values (or percentages when |
minimum_value_to_show |
(numeric; default 0) When
|
label_size |
(numeric; default 3.2) Font size (in ggplot2 mm
units) for taxa labels when |
value_size |
(numeric; default 3) Font size (in ggplot2 mm
units) for value labels when |
top_label_size |
(numeric; default 3.2) Font size (in ggplot2 mm
units) for the top group labels when |
bar_width |
(numeric; default NULL set 0.9 if |
bar_internal_color |
(default NA) Color of bar borders. Use |
linewidth_bar_internal |
(default 0 if |
show_n_samples |
(logical; default |
n_sample_text_size |
(numeric; default |
A ggplot2 plot with bar representing the
number of sequence en each taxonomic groups
Adrien Taudière
plot_tax_pq() and multitax_bar_pq()
data_fungi_ab <- subset_taxa_pq( data_fungi_mini, taxa_sums(data_fungi_mini) > 1000 ) tax_bar_pq(data_fungi_ab) + theme(legend.position = "none") tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Height", show_n_samples = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class") tax_bar_pq(data_fungi_ab, taxa = "Class", percent_bar = TRUE) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time") tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", percent_bar = TRUE, add_ribbon = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", percent_bar = TRUE, add_ribbon = TRUE, label_taxa = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", show_values = TRUE, minimum_value_to_show = 10000 ) tax_bar_pq(data_fungi_ab, fact = "Height", taxa = "Class", nb_seq = FALSE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 7, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 6, minimum_value_to_show = 0.05 ) |> reorder_distinct_colors(alternate_lightness = TRUE) tax_bar_pq(data_fungi_mini, fact = "Height", taxa = "Order", nb_seq = TRUE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 5, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 8, minimum_value_to_show = 0.05, bar_width = NULL, linewidth_bar_internal = 0.1, bar_internal_color = "black" ) |> reorder_distinct_colors(alternate_lightness = TRUE)data_fungi_ab <- subset_taxa_pq( data_fungi_mini, taxa_sums(data_fungi_mini) > 1000 ) tax_bar_pq(data_fungi_ab) + theme(legend.position = "none") tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Height", show_n_samples = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class") tax_bar_pq(data_fungi_ab, taxa = "Class", percent_bar = TRUE) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time") tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", percent_bar = TRUE, add_ribbon = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", percent_bar = TRUE, add_ribbon = TRUE, label_taxa = TRUE ) tax_bar_pq(data_fungi_ab, taxa = "Class", fact = "Time", show_values = TRUE, minimum_value_to_show = 10000 ) tax_bar_pq(data_fungi_ab, fact = "Height", taxa = "Class", nb_seq = FALSE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 7, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 6, minimum_value_to_show = 0.05 ) |> reorder_distinct_colors(alternate_lightness = TRUE) tax_bar_pq(data_fungi_mini, fact = "Height", taxa = "Order", nb_seq = TRUE, percent_bar = TRUE, label_taxa = TRUE, add_ribbon = TRUE, value_size = 5, ribbon_alpha = .6, show_values = TRUE, label_size = 4, top_label_size = 8, minimum_value_to_show = 0.05, bar_width = NULL, linewidth_bar_internal = 0.1, bar_internal_color = "black" ) |> reorder_distinct_colors(alternate_lightness = TRUE)
phyloseq-class objectAn interactive table for phyloseq taxonomy.
tax_datatable( physeq, abundance = TRUE, taxonomic_level = NULL, modality = NULL, ... )tax_datatable( physeq, abundance = TRUE, taxonomic_level = NULL, modality = NULL, ... )
physeq |
(required) a |
abundance |
(logical, default TRUE) Does the number of sequences is print |
taxonomic_level |
(default: NULL) a vector of selected taxonomic level using their column numbers (e.g. taxonomic_level = 1:7) |
modality |
(default: NULL) A sample modality to split OTU abundancy by level of the modality |
... |
Other argument for the datatable function |
A datatable
Adrien Taudière
data("GlobalPatterns", package = "phyloseq") if (requireNamespace("DT")) { tax_datatable(subset_taxa( GlobalPatterns, rowSums(GlobalPatterns@otu_table) > 10000 )) # Using modality tax_datatable(GlobalPatterns, modality = GlobalPatterns@sam_data$SampleType ) }data("GlobalPatterns", package = "phyloseq") if (requireNamespace("DT")) { tax_datatable(subset_taxa( GlobalPatterns, rowSums(GlobalPatterns@otu_table) > 10000 )) # Using modality tax_datatable(GlobalPatterns, modality = GlobalPatterns@sam_data$SampleType ) }
Mainly for internal use. It is a special case of clean_pq function.
taxa_as_columns(physeq)taxa_as_columns(physeq)
physeq |
(required) a |
A new phyloseq-class object
Adrien Taudière
taxa_as_columns(data_fungi_mini)taxa_as_columns(data_fungi_mini)
Mainly for internal use. It is a special case of clean_pq function.
taxa_as_rows(physeq)taxa_as_rows(physeq)
physeq |
(required) a |
A new phyloseq-class object
Adrien Taudière
taxa_as_rows(data_fungi_mini)taxa_as_rows(data_fungi_mini)
Given one modality name in sam_data and one level of the modality, return the taxa strictly specific of this level.
taxa_only_in_one_level( physeq, modality, level, min_nb_seq_taxa = 0, min_nb_samples_taxa = 0 ) taxa_only_in_one_level( physeq, modality, level, min_nb_seq_taxa = 0, min_nb_samples_taxa = 0 )taxa_only_in_one_level( physeq, modality, level, min_nb_seq_taxa = 0, min_nb_samples_taxa = 0 ) taxa_only_in_one_level( physeq, modality, level, min_nb_seq_taxa = 0, min_nb_samples_taxa = 0 )
physeq |
(required) a |
modality |
(required) The name of a column present in the |
level |
(required) The level (must be present in modality) of interest |
min_nb_seq_taxa |
(default 0 = no filter) The minimum number of sequences per taxa |
min_nb_samples_taxa |
(default 0 = no filter) The minimum number of samples per taxa |
A vector of taxa names
A vector of taxa names
Adrien Taudière
data_fungi_mini_woNA4height <- subset_samples( data_fungi_mini, !is.na(data_fungi_mini@sam_data$Height) ) taxa_only_in_one_level(data_fungi_mini_woNA4height, "Height", "High") #' # Taxa present only in low height samples suppressMessages(suppressWarnings( taxa_only_in_one_level(data_fungi, "Height", "Low") )) # Number of taxa present only in sample of time equal to 15 suppressMessages(suppressWarnings( length(taxa_only_in_one_level(data_fungi, "Time", "15")) )) data_fungi_mini_woNA4height <- subset_samples( data_fungi_mini, !is.na(data_fungi_mini@sam_data$Height) ) taxa_only_in_one_level(data_fungi_mini_woNA4height, "Height", "High") #' # Taxa present only in low height samples suppressMessages(suppressWarnings( taxa_only_in_one_level(data_fungi, "Height", "Low") )) # Number of taxa present only in sample of time equal to 15 suppressMessages(suppressWarnings( length(taxa_only_in_one_level(data_fungi, "Time", "15")) ))data_fungi_mini_woNA4height <- subset_samples( data_fungi_mini, !is.na(data_fungi_mini@sam_data$Height) ) taxa_only_in_one_level(data_fungi_mini_woNA4height, "Height", "High") #' # Taxa present only in low height samples suppressMessages(suppressWarnings( taxa_only_in_one_level(data_fungi, "Height", "Low") )) # Number of taxa present only in sample of time equal to 15 suppressMessages(suppressWarnings( length(taxa_only_in_one_level(data_fungi, "Time", "15")) )) data_fungi_mini_woNA4height <- subset_samples( data_fungi_mini, !is.na(data_fungi_mini@sam_data$Height) ) taxa_only_in_one_level(data_fungi_mini_woNA4height, "Height", "High") #' # Taxa present only in low height samples suppressMessages(suppressWarnings( taxa_only_in_one_level(data_fungi, "Height", "Low") )) # Number of taxa present only in sample of time equal to 15 suppressMessages(suppressWarnings( length(taxa_only_in_one_level(data_fungi, "Time", "15")) ))
A wrapper for the gtsummary::tbl_summary() function in the case of physeq
object.
tbl_sum_samdata(physeq, remove_col_unique_value = TRUE, ...)tbl_sum_samdata(physeq, remove_col_unique_value = TRUE, ...)
physeq |
(required) a |
remove_col_unique_value |
(logical, default TRUE) Do we remove informative columns (categorical column with one value per samples), e.g. samples names ? |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to gtsummary::tbl_summary() if you
use this function.
A new phyloseq-class object with a larger slot tax_table
Adrien Taudière
if (requireNamespace("gtsummary")) { tbl_sum_samdata(data_fungi) %>% gtsummary::as_kable() summary_samdata <- tbl_sum_samdata(data_fungi, include = c("Time", "Height"), type = list(Time ~ "continuous2", Height ~ "categorical"), statistic = list(Time ~ c("{median} ({p25}, {p75})", "{min}, {max}")) ) } data(enterotype) if (requireNamespace("gtsummary")) { summary_samdata <- tbl_sum_samdata(enterotype) summary_samdata <- tbl_sum_samdata(enterotype, include = !contains("SampleId")) }if (requireNamespace("gtsummary")) { tbl_sum_samdata(data_fungi) %>% gtsummary::as_kable() summary_samdata <- tbl_sum_samdata(data_fungi, include = c("Time", "Height"), type = list(Time ~ "continuous2", Height ~ "categorical"), statistic = list(Time ~ c("{median} ({p25}, {p75})", "{min}, {max}")) ) } data(enterotype) if (requireNamespace("gtsummary")) { summary_samdata <- tbl_sum_samdata(enterotype) summary_samdata <- tbl_sum_samdata(enterotype, include = !contains("SampleId")) }
Mainly a wrapper for the gtsummary::tbl_summary() function in the case
of physeq object.
tbl_sum_taxtable(physeq, taxonomic_ranks = NULL, ...)tbl_sum_taxtable(physeq, taxonomic_ranks = NULL, ...)
physeq |
(required) a |
taxonomic_ranks |
A list of taxonomic ranks we want to summarized. |
... |
Additional arguments passed on to |
A table of class c('tbl_summary', 'gtsummary')
Adrien Taudière
tbl_sum_taxtable(data_fungi_mini) data_fungi_mini |> filt_taxa_pq(min_occurence = 2) |> tbl_sum_taxtable(taxonomic_rank = c("Species", "Genus"))tbl_sum_taxtable(data_fungi_mini) data_fungi_mini |> filt_taxa_pq(min_occurence = 2) |> tbl_sum_taxtable(taxonomic_rank = c("Species", "Genus"))
mia package.
obtained using mia::makePhyloseqFromTreeSE(Tengeler2020)
This is a phyloseq version of the Tengeler2020 dataset.
data(Tengeler2020_pq)data(Tengeler2020_pq)
A phyloseq object
Tengeler2020 includes gut microbiota profiles of 27 persons with ADHD. A standard bioinformatic and statistical analysis done to demonstrate that altered microbial composition could be a driver of altered brain structure and function and concomitant changes in the animals behavior. This was investigated by colonizing young, male, germ-free C57BL/6JOlaHsd mice with microbiota from individuals with and without ADHD.
Tengeler, A.C., Dam, S.A., Wiesmann, M. et al. Gut microbiota from persons with attention-deficit/hyperactivity disorder affects the brain in mice. Microbiome 8, 44 (2020). https://microbiomejournal.biomedcentral.com/articles/10.1186/s40168-020-00816-x
Wrapper around edgeR::calcNormFactors() with method = "TMM"
(Robinson & Oshlack 2010, doi:10.1186/gb-2010-11-3-r25). Returns
counts-per-million scaled by the TMM-derived library sizes.
tmm_pq(physeq, log = FALSE)tmm_pq(physeq, log = FALSE)
physeq |
(required) a |
log |
(logical, default |
A new phyloseq-class object with a TMM
normalised otu_table.
Adrien Taudière
edgeR::calcNormFactors(), edgeR::cpm()
data_f_tmm <- tmm_pq(data_fungi_mini)data_f_tmm <- tmm_pq(data_fungi_mini)
List of fastq and fastg.gz files -> nb of reads and samples
List of dada-class -> nb of reads, clusters (ASV) and samples
List of derep-class -> nb of reads, clusters (unique sequences) and samples
Matrix of samples x clusters (e.g. otu_table) -> nb of reads,
clusters and samples
Phyloseq-class -> nb of reads, clusters and samples
track_wkflow( list_of_objects, obj_names = NULL, clean_pq = FALSE, taxonomy_rank = NULL, verbose = TRUE, ... )track_wkflow( list_of_objects, obj_names = NULL, clean_pq = FALSE, taxonomy_rank = NULL, verbose = TRUE, ... )
list_of_objects |
(required) a list of objects |
obj_names |
A list of names corresponding to the list of objects |
clean_pq |
(logical) If set to TRUE, empty samples and empty ASV are discarded before clustering. |
taxonomy_rank |
A vector of int. Define the column number of
taxonomic rank |
verbose |
(logical) If true, print some additional messages. |
... |
Additional arguments passed on to |
The number of sequences, clusters (e.g. OTUs, ASVs) and samples for each object.
Adrien Taudière
data(enterotype) if (requireNamespace("pbapply")) { track_wkflow(list(data_fungi_mini, enterotype), taxonomy_rank = c(3, 5)) track_wkflow(list( "data FUNGI" = data_fungi_mini, "fastq files forward" = unlist(list_fastq_files(system.file("extdata", package = "MiscMetabar"), paired_end = FALSE )) )) }data(enterotype) if (requireNamespace("pbapply")) { track_wkflow(list(data_fungi_mini, enterotype), taxonomy_rank = c(3, 5)) track_wkflow(list( "data FUNGI" = data_fungi_mini, "fastq files forward" = unlist(list_fastq_files(system.file("extdata", package = "MiscMetabar"), paired_end = FALSE )) )) }
Accept all input types supported by track_wkflow(): phyloseq objects,
matrices (samples x clusters), dada-class, derep-class, lists of
dada-class or derep-class, and character vectors of fastq/fastq.gz file
paths.
More information are available in the manual of the function track_wkflow()
track_wkflow_samples(list_of_objects, output_data_frame = FALSE, ...)track_wkflow_samples(list_of_objects, output_data_frame = FALSE, ...)
list_of_objects |
(required) a list of objects passed on to
|
output_data_frame |
(logical, default FALSE) If TRUE, the function returns a data frame with the number of sequences, clusters and samples for each sample. |
... |
Other args passed on to |
A list of dataframe. cf track_wkflow() for more information
Adrien Taudière
tree_A10_005 <- subset_samples(data_fungi, Tree_name == "A10-005") if (requireNamespace("pbapply")) { track_wkflow_samples(tree_A10_005) }tree_A10_005 <- subset_samples(data_fungi, Tree_name == "A10-005") if (requireNamespace("pbapply")) { track_wkflow_samples(tree_A10_005) }
Single entry-point for all count-table transformations available in
MiscMetabar. Ecological methods ("tss", "hellinger", "clr",
"rclr", "log1p", "z", "pa", "rank") are delegated to
vegan::decostand(). Library-size normalisation methods ("rarefy",
"srs", "gmpr", "css", "tmm", "vst") and the McKnight
log-log residual method ("mcknight_residuals") are delegated to
their dedicated *_pq() functions. All ... arguments are forwarded
to the underlying function.
transform_pq( physeq, method = c("tss", "hellinger", "clr", "rclr", "log1p", "z", "pa", "rank", "normalize_prop", "rarefy", "srs", "gmpr", "css", "tmm", "vst", "mcknight_residuals"), pseudocount = 1, ... )transform_pq( physeq, method = c("tss", "hellinger", "clr", "rclr", "log1p", "z", "pa", "rank", "normalize_prop", "rarefy", "srs", "gmpr", "css", "tmm", "vst", "mcknight_residuals"), pseudocount = 1, ... )
physeq |
(required) a |
method |
(character, default
|
pseudocount |
(numeric, default |
... |
Additional arguments forwarded to the underlying function
( |
A new phyloseq-class object with a
transformed otu_table (and augmented sample_data for
"mcknight_residuals").
Adrien Taudière
normalize_prop_pq(), rarefy_pq(), srs_pq(), gmpr_pq(),
css_pq(), tmm_pq(), vst_pq(), mcknight_residuals_pq(),
as_binary_otu_table(), vegan::decostand()
data_f_tss <- transform_pq(data_fungi_mini, method = "tss") sample_sums(data_f_tss) data_f_hell <- transform_pq(data_fungi_mini, method = "hellinger") data_f_clr <- transform_pq(data_fungi_mini, method = "clr") data_f_rclr <- transform_pq(data_fungi_mini, method = "rclr") data_f_log1p <- transform_pq(data_fungi_mini, method = "log1p") data_f_z <- transform_pq(data_fungi_mini, method = "z") data_f_pa <- transform_pq(data_fungi_mini, method = "pa") data_f_rank <- transform_pq(data_fungi_mini, method = "rank") data_f_norm_prop_log10 <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = 10 ) data_f_norm_prop_no_log <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = NULL ) data_f_norm_prop_log2 <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = 2 ) data_f_rarefy <- transform_pq(data_fungi_mini, method = "rarefy", seed = 1) data_f_srs <- transform_pq(data_fungi_mini, method = "srs", seed = 1) data_f_gmpr <- transform_pq(data_fungi_mini, method = "gmpr") data_f_css <- transform_pq(data_fungi_mini, method = "css") data_f_tmm <- transform_pq(data_fungi_mini, method = "tmm") data_f_vst <- transform_pq(data_fungi_mini, method = "vst") data_f_mcknight <- transform_pq(data_fungi_mini, method = "mcknight_residuals") otu_list <- list( hell = unclass(data_f_hell@otu_table), clr = unclass(data_f_clr@otu_table), rclr = unclass(data_f_rclr@otu_table), log1p = unclass(data_f_log1p@otu_table), z = unclass(data_f_z@otu_table), rarefy = unclass(data_f_rarefy@otu_table) ) pairs_cor <- sapply( otu_list, \(x) sapply(otu_list, \(y) cor(as.vector(x), as.vector(y))) ) pairs_cor plot(unclass(data_f_mcknight@otu_table), unclass(data_f_css@otu_table)) plot(unclass(data_f_rarefy@otu_table), unclass(data_f_clr@otu_table))data_f_tss <- transform_pq(data_fungi_mini, method = "tss") sample_sums(data_f_tss) data_f_hell <- transform_pq(data_fungi_mini, method = "hellinger") data_f_clr <- transform_pq(data_fungi_mini, method = "clr") data_f_rclr <- transform_pq(data_fungi_mini, method = "rclr") data_f_log1p <- transform_pq(data_fungi_mini, method = "log1p") data_f_z <- transform_pq(data_fungi_mini, method = "z") data_f_pa <- transform_pq(data_fungi_mini, method = "pa") data_f_rank <- transform_pq(data_fungi_mini, method = "rank") data_f_norm_prop_log10 <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = 10 ) data_f_norm_prop_no_log <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = NULL ) data_f_norm_prop_log2 <- transform_pq(data_fungi_mini, method = "normalize_prop", base_log = 2 ) data_f_rarefy <- transform_pq(data_fungi_mini, method = "rarefy", seed = 1) data_f_srs <- transform_pq(data_fungi_mini, method = "srs", seed = 1) data_f_gmpr <- transform_pq(data_fungi_mini, method = "gmpr") data_f_css <- transform_pq(data_fungi_mini, method = "css") data_f_tmm <- transform_pq(data_fungi_mini, method = "tmm") data_f_vst <- transform_pq(data_fungi_mini, method = "vst") data_f_mcknight <- transform_pq(data_fungi_mini, method = "mcknight_residuals") otu_list <- list( hell = unclass(data_f_hell@otu_table), clr = unclass(data_f_clr@otu_table), rclr = unclass(data_f_rclr@otu_table), log1p = unclass(data_f_log1p@otu_table), z = unclass(data_f_z@otu_table), rarefy = unclass(data_f_rarefy@otu_table) ) pairs_cor <- sapply( otu_list, \(x) sapply(otu_list, \(y) cor(as.vector(x), as.vector(y))) ) pairs_cor plot(unclass(data_f_mcknight@otu_table), unclass(data_f_css@otu_table)) plot(unclass(data_f_rarefy@otu_table), unclass(data_f_clr@otu_table))
Adds transparency to a vector of colors
transp(col, alpha = 0.5)transp(col, alpha = 0.5)
col |
a vector of colors |
alpha |
(default 0.5) a numeric value between 0 and 1 representing the alpha coefficient; 0: total transparency; 1: no transparency. |
a color vector
Thibaut Jombart in adegenet package
The R package RColorBrewer, proposing a nice selection of color palettes. The viridis package, with many excellent palettes
transp("red") transp(c("red", "blue"), alpha = 0.3)transp("red") transp(c("red", "blue"), alpha = 0.3)
Note that lvl2need to be nested in lvl1
treemap_pq( physeq, lvl1, lvl2, nb_seq = TRUE, log10trans = TRUE, plot_legend = FALSE, show_count = FALSE, facet_by = NULL, growing_text = TRUE, text_size = 15, show_na = TRUE, na_label = "NA", min_text_size = 0, ... )treemap_pq( physeq, lvl1, lvl2, nb_seq = TRUE, log10trans = TRUE, plot_legend = FALSE, show_count = FALSE, facet_by = NULL, growing_text = TRUE, text_size = 15, show_na = TRUE, na_label = "NA", min_text_size = 0, ... )
physeq |
(required) a |
lvl1 |
(required) Name of the first (higher) taxonomic rank of interest |
lvl2 |
(required) Name of the second (lower) taxonomic rank of interest |
nb_seq |
(logical; default TRUE) If set to FALSE, only the number of ASV is count. Concretely, physeq otu_table is transformed in a binary otu_table (each value different from zero is set to one) |
log10trans |
(logical, default TRUE) If TRUE, the number of sequences (or ASV if nb_seq = FALSE) is log10(x + 1) transformed. The +1 ensures that taxa with a count of 1 still have a visible tile area. |
plot_legend |
(logical, default FALSE) If TRUE, plot che legend of color for lvl 1 |
show_count |
(logical, default FALSE) If TRUE, appends the raw
count in parentheses after each |
facet_by |
(character, default NULL) Name of a column in
|
growing_text |
(logical, default TRUE) If FALSE, all tile labels are drawn at the same font size (disables per-tile text growing), which corresponds to the smallest size that would otherwise be computed. |
text_size |
(numeric, default 15) Base font size for tile labels.
Mostly useful when |
show_na |
(logical, default TRUE) If TRUE, taxa with NA values for
|
na_label |
(character, default "NA") Label used to replace NA values
in |
min_text_size |
(numeric, default 0) Minimum font size in points for tile labels. Labels that would be smaller than this are hidden. Set to 0 to always show all labels. |
... |
Additional arguments passed on to
|
A ggplot2 object
Adrien Taudière
data(data_fungi_sp_known) if (requireNamespace("treemapify")) { treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", plot_legend = TRUE ) } if (requireNamespace("treemapify")) { treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", log10trans = FALSE ) treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", nb_seq = FALSE, log10trans = FALSE ) treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", show_count = TRUE, log10trans = FALSE ) }data(data_fungi_sp_known) if (requireNamespace("treemapify")) { treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", plot_legend = TRUE ) } if (requireNamespace("treemapify")) { treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", log10trans = FALSE ) treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", nb_seq = FALSE, log10trans = FALSE ) treemap_pq( clean_pq(subset_taxa( data_fungi_sp_known, Phylum == "Basidiomycota" )), "Order", "Class", show_count = TRUE, log10trans = FALSE ) }
Compute tSNE position of samples from a phyloseq object
tsne_pq(physeq, method = "bray", dims = 2, theta = 0, perplexity = 30, ...)tsne_pq(physeq, method = "bray", dims = 2, theta = 0, perplexity = 30, ...)
physeq |
(required) a |
method |
A method to calculate distance using |
dims |
(Int) Output dimensionality (default: 2) |
theta |
(Numeric) Speed/accuracy trade-off (increase for less accuracy), set to 0.0 for exact TSNE (default: 0.0 see details in the man page of |
perplexity |
(Numeric) Perplexity parameter (should not be bigger than 3 * perplexity < nrow(X) - 1, see details in the man page of |
... |
Additional arguments passed on to |
A list of element including the matrix Y containing the new representations for the objects. See ?Rtsne::Rtsne() for more information
if (requireNamespace("Rtsne")) { res_tsne <- tsne_pq(data_fungi_mini) }if (requireNamespace("Rtsne")) { res_tsne <- tsne_pq(data_fungi_mini) }
https://journals.asm.org/doi/full/10.1128/msystems.00691-21
umap_pq(physeq, pkg = "umap", ...)umap_pq(physeq, pkg = "umap", ...)
physeq |
(required) a |
pkg |
Which R packages to use, either "umap" or "uwot". |
... |
Additional arguments passed on to |
This function is mainly a wrapper of the work of others.
Please make a reference to umap::umap() if you
use this function.
A dataframe with samples informations and the x_umap and y_umap position
Adrien Taudière
umap::umap(), tsne_pq(), phyloseq::plot_ordination()
library("umap") data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) df_umap <- umap_pq(data_f, n_neighbors = 3) ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) ## Not run: df_uwot <- umap_pq(data_fungi_mini, pkg = "uwot") library(patchwork) physeq <- data_fungi_mini df_umap <- umap_pq(physeq, n_neighbors = 3) res_tsne <- tsne_pq(data_fungi_mini) df_umap_tsne <- df_umap df_umap_tsne$x_tsne <- res_tsne$Y[, 1] df_umap_tsne$y_tsne <- res_tsne$Y[, 2] ((ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("UMAP")) + (plot_ordination(physeq, ordination = ordinate(physeq, method = "PCoA", distance = "bray"), color = "Height" ) + ggtitle("PCoA"))) / ((ggplot(df_umap_tsne, aes(x = x_tsne, y = y_tsne, col = Height)) + geom_point(size = 2) + ggtitle("tsne")) + (plot_ordination(physeq, ordination = ordinate(physeq, method = "NMDS", distance = "bray"), color = "Height" ) + ggtitle("NMDS"))) + patchwork::plot_layout(guides = "collect") (ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("umap::umap")) / (ggplot(df_uwot, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("uwot::umap2")) ## End(Not run)library("umap") data_f <- prune_samples( sample_names(data_fungi_mini)[1:20], data_fungi_mini ) df_umap <- umap_pq(data_f, n_neighbors = 3) ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) ## Not run: df_uwot <- umap_pq(data_fungi_mini, pkg = "uwot") library(patchwork) physeq <- data_fungi_mini df_umap <- umap_pq(physeq, n_neighbors = 3) res_tsne <- tsne_pq(data_fungi_mini) df_umap_tsne <- df_umap df_umap_tsne$x_tsne <- res_tsne$Y[, 1] df_umap_tsne$y_tsne <- res_tsne$Y[, 2] ((ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("UMAP")) + (plot_ordination(physeq, ordination = ordinate(physeq, method = "PCoA", distance = "bray"), color = "Height" ) + ggtitle("PCoA"))) / ((ggplot(df_umap_tsne, aes(x = x_tsne, y = y_tsne, col = Height)) + geom_point(size = 2) + ggtitle("tsne")) + (plot_ordination(physeq, ordination = ordinate(physeq, method = "NMDS", distance = "bray"), color = "Height" ) + ggtitle("NMDS"))) + patchwork::plot_layout(guides = "collect") (ggplot(df_umap, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("umap::umap")) / (ggplot(df_uwot, aes(x = x_umap, y = y_umap, col = Height)) + geom_point(size = 2) + ggtitle("uwot::umap2")) ## End(Not run)
If unique(x) is a single value, return it; otherwise, return an NA of the
same type as x. If x is a factor, then the levels and ordered status
will be kept in either case. If x is a non-atomic vector (i.e. a list),
then the logical NA will be used.
unique_or_na(x)unique_or_na(x)
x |
A vector |
Either a single value (if unique(x) return a single value) or a NA
Michael R. McLaren (orcid: 0000-0003-1575-473X)
f <- factor(c("a", "a", "b", "c"), ordered = TRUE) unique_or_na(f) unique_or_na(f[1:2]) x <- c("a", "b", "a") unique_or_na(x[c(1, 3)]) unique_or_na(x) unique_or_na(x) |> typeof()f <- factor(c("a", "a", "b", "c"), ordered = TRUE) unique_or_na(f) unique_or_na(f[1:2]) x <- c("a", "b", "a") unique_or_na(x[c(1, 3)]) unique_or_na(x) unique_or_na(x) |> typeof()
A named character vector of regular expressions used to identify common problematic values in taxonomy tables. Each element is a regex pattern; names provide human-readable descriptions.
Used as the default replace_to_NA argument in verify_tax_table() and
can be reused by other pqverse packages (e.g. dbpq::count_unwanted_tax()).
unwanted_tax_patternsunwanted_tax_patterns
A named character vector with 17 elements:
"^[Nn][Aa][Nn]?$"
"^[Nn]/[Aa]$"
"^[Nn]one$"
"^$"
"^\\\\s+$"
"[Uu]nclassified"
"[Uu]nknown"
"[Uu]nidentified"
"[Uu]ncultured"
"[Ii]ncertae[_\\\\s]?[Ss]edis"
"^[Mm]etagenome$"
"^[Ee]nvironmental"
"^[kpcofgs]__$"
"^_sp"
"^_species"
"_uc$"
"__X+$"
unwanted_tax_patterns # Use with grepl to check a value any(vapply( unwanted_tax_patterns, \(pat) grepl(pat, "unclassified"), logical(1) ))unwanted_tax_patterns # Use with grepl to check a value any(vapply( unwanted_tax_patterns, \(pat) grepl(pat, "unclassified"), logical(1) ))
Alternative to venn plot.
upset_pq( physeq, fact, taxa_fill = NULL, min_nb_seq = 0, na_remove = TRUE, numeric_fonction = sum, rarefy_after_merging = FALSE, rngseed = FALSE, verbose = TRUE, ... )upset_pq( physeq, fact, taxa_fill = NULL, min_nb_seq = 0, na_remove = TRUE, numeric_fonction = sum, rarefy_after_merging = FALSE, rngseed = FALSE, verbose = TRUE, ... )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
taxa_fill |
(default NULL) fill the ASV upset using a column in
|
min_nb_seq |
minimum number of sequences by OTUs by samples to take into count this OTUs in this sample. For example, if min_nb_seq=2,each value of 2 or less in the OTU table will not count in the venn diagram |
na_remove |
: if TRUE (the default), NA values in fact are removed if FALSE, NA values are set to "NA" |
numeric_fonction |
(default : sum) the function for numeric vector useful only for complex plot (see examples) |
rarefy_after_merging |
Rarefy each sample after merging by the
modalities of |
rngseed |
(Optional). A single integer value passed to
|
verbose |
(logical). If TRUE, print additional information. |
... |
Additional arguments passed on to the |
A ggplot2 plot
Adrien Taudière
if (requireNamespace("ComplexUpset") && packageVersion("ggplot2") < "4.0.0") { upset_pq(data_fungi_mini, fact = "Height", width_ratio = 0.2, taxa_fill = "Class" ) } if (requireNamespace("ComplexUpset") && packageVersion("ggplot2") < "4.0.0") { upset_pq(data_fungi_mini, fact = "Height", min_nb_seq = 1000) upset_pq(data_fungi_mini, fact = "Height", na_remove = FALSE) upset_pq(data_fungi_mini, fact = "Time", width_ratio = 0.2, rarefy_after_merging = TRUE) upset_pq( data_fungi_mini, fact = "Time", width_ratio = 0.2, annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Phylum)) + geom_bar() + ylab("ASV per phylum") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) upset_pq( data_fungi_mini, fact = "Time", width_ratio = 0.2, numeric_fonction = mean, annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Phylum)) + geom_bar() + ylab("ASV per phylum") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) upset_pq( subset_taxa(data_fungi_mini, Phylum == "Basidiomycota"), fact = "Time", width_ratio = 0.2, base_annotations = list(), annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Class)) + geom_bar() + ylab("ASV per Class") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) data_fungi2 <- data_fungi_mini data_fungi2@sam_data[["Time_0"]] <- data_fungi2@sam_data$Time == 0 data_fungi2@sam_data[["Height__Time_0"]] <- paste0(data_fungi2@sam_data[["Height"]], "__", data_fungi2@sam_data[["Time_0"]]) data_fungi2@sam_data[["Height__Time_0"]][grepl("NA", data_fungi2@sam_data[["Height__Time_0"]])] <- NA upset_pq(data_fungi2, fact = "Height__Time_0", width_ratio = 0.2, min_size = 2) }if (requireNamespace("ComplexUpset") && packageVersion("ggplot2") < "4.0.0") { upset_pq(data_fungi_mini, fact = "Height", width_ratio = 0.2, taxa_fill = "Class" ) } if (requireNamespace("ComplexUpset") && packageVersion("ggplot2") < "4.0.0") { upset_pq(data_fungi_mini, fact = "Height", min_nb_seq = 1000) upset_pq(data_fungi_mini, fact = "Height", na_remove = FALSE) upset_pq(data_fungi_mini, fact = "Time", width_ratio = 0.2, rarefy_after_merging = TRUE) upset_pq( data_fungi_mini, fact = "Time", width_ratio = 0.2, annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Phylum)) + geom_bar() + ylab("ASV per phylum") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) upset_pq( data_fungi_mini, fact = "Time", width_ratio = 0.2, numeric_fonction = mean, annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Phylum)) + geom_bar() + ylab("ASV per phylum") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) upset_pq( subset_taxa(data_fungi_mini, Phylum == "Basidiomycota"), fact = "Time", width_ratio = 0.2, base_annotations = list(), annotations = list( "Sequences per ASV \n (log10)" = ( ggplot(mapping = aes(y = log10(Abundance))) + geom_jitter(aes( color = Abundance ), na.rm = TRUE) + geom_violin(alpha = 0.5, na.rm = TRUE) + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ), "ASV per phylum" = ( ggplot(mapping = aes(fill = Class)) + geom_bar() + ylab("ASV per Class") + theme(legend.key.size = unit(0.2, "cm")) + theme(axis.text = element_text(size = 12)) ) ) ) data_fungi2 <- data_fungi_mini data_fungi2@sam_data[["Time_0"]] <- data_fungi2@sam_data$Time == 0 data_fungi2@sam_data[["Height__Time_0"]] <- paste0(data_fungi2@sam_data[["Height"]], "__", data_fungi2@sam_data[["Time_0"]]) data_fungi2@sam_data[["Height__Time_0"]][grepl("NA", data_fungi2@sam_data[["Height__Time_0"]])] <- NA upset_pq(data_fungi2, fact = "Height__Time_0", width_ratio = 0.2, min_size = 2) }
See upset_pq() to plot upset. There is a bug with ggplot2 >= 4.0.0. See issue
https://github.com/krassowski/complex-upset/issues/213 for more details.
upset_test_pq( physeq, fact, var_to_test = "OTU", min_nb_seq = 0, na_remove = TRUE, numeric_fonction = sum, ... )upset_test_pq( physeq, fact, var_to_test = "OTU", min_nb_seq = 0, na_remove = TRUE, numeric_fonction = sum, ... )
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
var_to_test |
(default c("OTU")) : a vector of column present in the tax_table slot from the physeq object |
min_nb_seq |
minimum number of sequences by OTUs by samples to take into count this OTUs in this sample. For example, if min_nb_seq=2,each value of 2 or less in the OTU table will not count in the venn diagram |
na_remove |
: if TRUE (the default), NA values in fact are removed if FALSE, NA values are set to "NA" |
numeric_fonction |
(default : sum) the function for numeric vector useful only for complex plot (see examples) |
... |
Additional arguments passed on to the |
A ggplot2 plot
Adrien Taudière
if (requireNamespace("ComplexUpset")) { upset_test_pq(data_fungi_mini, "Height", var_to_test = c("OTU", "Class", "Guild") ) upset_test_pq(data_fungi_mini, "Time") }if (requireNamespace("ComplexUpset")) { upset_test_pq(data_fungi_mini, "Height", var_to_test = c("OTU", "Class", "Guild") ) upset_test_pq(data_fungi_mini, "Time") }
The function partitions the variation in otu_table using
distance (Bray per default) with respect to two, three, or four explanatory
tables, using
adjusted R² in redundancy analysis ordination (RDA) or distance-based
redundancy analysis. If response is a single vector, partitioning is by
partial regression. Collinear variables in the explanatory tables do NOT
have to be removed prior to partitioning. See vegan::varpart() for more
information.
var_par_pq( physeq, list_component, dist_method = "bray", dbrda_computation = TRUE )var_par_pq( physeq, list_component, dist_method = "bray", dbrda_computation = TRUE )
physeq |
(required) a |
list_component |
(required) A named list of 2, 3 or four vectors with
names from the |
dist_method |
(default "bray") the distance used. See
|
dbrda_computation |
(logical) Do dbrda computations are runned for each individual component (each name of the list component) ? |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::varpart() if you
use this function.
an object of class "varpart", see vegan::varpart()
Adrien Taudière
var_par_rarperm_pq(), vegan::varpart(), plot_var_part_pq()
if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples(data_fungi_mini, !is.na(Time) & !is.na(Height)) res_var <- var_par_pq(data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), dbrda_computation = TRUE ) }if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples(data_fungi_mini, !is.na(Time) & !is.na(Height)) res_var <- var_par_pq(data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), dbrda_computation = TRUE ) }
This is an extension of the function var_par_pq(). The main addition is
the computation of nperm permutations with rarefaction even depth by
sample. The return object
var_par_rarperm_pq( physeq, list_component, dist_method = "bray", nperm = 99, quantile_prob = 0.975, dbrda_computation = FALSE, dbrda_signif_pval = 0.05, sample.size = min(sample_sums(physeq)), verbose = FALSE, progress_bar = TRUE )var_par_rarperm_pq( physeq, list_component, dist_method = "bray", nperm = 99, quantile_prob = 0.975, dbrda_computation = FALSE, dbrda_signif_pval = 0.05, sample.size = min(sample_sums(physeq)), verbose = FALSE, progress_bar = TRUE )
physeq |
(required) a |
list_component |
(required) A named list of 2, 3 or four vectors with
names from the |
dist_method |
(default "bray") the distance used. See
|
nperm |
(int) The number of permutations to perform. |
quantile_prob |
(float, |
dbrda_computation |
(logical) Do dbrda computations are runned for each individual component (each name of the list component) ? |
dbrda_signif_pval |
(float, |
sample.size |
(int) A single integer value equal to the number of
reads being simulated, also known as the depth. See
|
verbose |
(logical). If TRUE, print additional information. |
progress_bar |
(logical, default TRUE) Do we print progress during the calculation? |
This function is mainly a wrapper of the work of others.
Please make a reference to vegan::varpart() if you
use this function.
A list of class varpart with additional information in the
$part$indfract part. Adj.R.square is the mean across permutation.
Adj.R.squared_quantil_min and Adj.R.squared_quantil_max represent
the quantile values of adjusted R squared
Adrien Taudière
var_par_pq(), vegan::varpart(), plot_var_part_pq()
if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples( data_fungi_mini, !is.na(Time) & !is.na(Height) ) res_var_2 <- var_par_rarperm_pq( data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), nperm = 2, dbrda_computation = TRUE ) } ## Not run: plot_var_part_pq(res_var_2) ## End(Not run)if (requireNamespace("vegan")) { data_fungi_woNA <- subset_samples( data_fungi_mini, !is.na(Time) & !is.na(Height) ) res_var_2 <- var_par_rarperm_pq( data_fungi_woNA, list_component = list( "Time" = c("Time"), "Size" = c("Height", "Diameter") ), nperm = 2, dbrda_computation = TRUE ) } ## Not run: plot_var_part_pq(res_var_2) ## End(Not run)
phyloseq-class objectGraphical representation of distribution of taxa across combined modality of a factor.
venn_pq(physeq, fact, min_nb_seq = 0, print_values = TRUE)venn_pq(physeq, fact, min_nb_seq = 0, print_values = TRUE)
physeq |
(required) a |
fact |
(required) Name of the factor to cluster samples by modalities.
Need to be in |
min_nb_seq |
(default: 0) minimum number of sequences by OTUs by samples to take into count this OTUs in this sample. For example, if min_nb_seq=2,each value of 2 or less in the OTU table will be change into 0 for the analysis |
print_values |
(logical) Print (or not) the table of number of OTUs for each combination. If print_values is TRUE the object is not a ggplot object. Please use print_values = FALSE if you want to add ggplot function (cf example). |
A ggplot2 plot representing Venn diagram of
modalities of the argument factor
Adrien Taudière
if (requireNamespace("venneuler")) { data("enterotype") venn_pq(enterotype, fact = "SeqTech") } if (requireNamespace("venneuler")) { venn_pq(enterotype, fact = "ClinicalStatus") venn_pq(enterotype, fact = "Nationality", print_values = FALSE) venn_pq(enterotype, fact = "ClinicalStatus", print_values = FALSE) + scale_fill_hue() venn_pq(enterotype, fact = "ClinicalStatus", print_values = FALSE) + scale_fill_hue() }if (requireNamespace("venneuler")) { data("enterotype") venn_pq(enterotype, fact = "SeqTech") } if (requireNamespace("venneuler")) { venn_pq(enterotype, fact = "ClinicalStatus") venn_pq(enterotype, fact = "Nationality", print_values = FALSE) venn_pq(enterotype, fact = "ClinicalStatus", print_values = FALSE) + scale_fill_hue() venn_pq(enterotype, fact = "ClinicalStatus", print_values = FALSE) + scale_fill_hue() }
Mostly for internal use in MiscMetabar functions.
verify_pq( physeq, verbose = FALSE, min_nb_seq_sample = 500, min_nb_seq_taxa = 1, check_taxonomy = FALSE, ... )verify_pq( physeq, verbose = FALSE, min_nb_seq_sample = 500, min_nb_seq_taxa = 1, check_taxonomy = FALSE, ... )
physeq |
(required) a |
verbose |
(logical, default FALSE) If TRUE, prompt some warnings. |
min_nb_seq_sample |
(numeric) Only used if verbose = TRUE. Minimum number of sequences per samples to not show warning. |
min_nb_seq_taxa |
(numeric) Only used if verbose = TRUE. Minimum number of sequences per taxa to not show warning. |
check_taxonomy |
(logical, default FALSE) If TRUE, call
|
... |
Additional arguments passed to |
Nothing if the phyloseq object is valid. An error in the other case. Warnings if verbose = TRUE or check_taxonomy = TRUE
Adrien Taudière
verify_pq(data_fungi_mini) verify_pq(data_fungi_mini, check_taxonomy = TRUE)verify_pq(data_fungi_mini) verify_pq(data_fungi_mini, check_taxonomy = TRUE)
Check taxonomy table for common issues and send warnings/messages accordingly.
This function is called by verify_pq() when check_taxonomy = TRUE.
verify_tax_table( physeq, verbose = TRUE, replace_to_NA = unwanted_tax_patterns, min_char = 4, redundant_suffix = "_sp", taxonomic_ranks = c("Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species"), modify_phyloseq = FALSE, remove_border_spaces = TRUE, remove_all_space = FALSE, replace_space_with = "_", detect_invisible_chars = TRUE, replace_invisible_chars = FALSE, invisible_chars_replacement = "" )verify_tax_table( physeq, verbose = TRUE, replace_to_NA = unwanted_tax_patterns, min_char = 4, redundant_suffix = "_sp", taxonomic_ranks = c("Domain", "Phylum", "Class", "Order", "Family", "Genus", "Species"), modify_phyloseq = FALSE, remove_border_spaces = TRUE, remove_all_space = FALSE, replace_space_with = "_", detect_invisible_chars = TRUE, replace_invisible_chars = FALSE, invisible_chars_replacement = "" )
physeq |
(required) a |
verbose |
(logical, default TRUE) If TRUE, print warnings and messages about potential taxonomy issues. |
replace_to_NA |
(character vector) A vector of regex patterns to identify values that should be considered as NA. Defaults to unwanted_tax_patterns, a named character vector of common placeholders like "unclassified", "unknown", "uncultured", "incertae_sedis", "metagenome", empty QIIME-style ranks, etc. |
min_char |
(integer, default 4) Minimum number of characters for a taxonomic value to be considered valid. Values with fewer characters (excluding NA) will trigger a warning when verbose = TRUE. |
redundant_suffix |
(character, default "_sp") Suffix pattern to detect redundant taxonomic information. For example, "Russula_sp" in Species column is redundant if "Russula" is already present in the Genus column. Set to NULL to disable this check. Other examples: "_var", "_ssp", "_cf". |
taxonomic_ranks |
(character vector, default NULL) Names of taxonomic ranks in hierarchical order from highest to lowest (e.g., c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species")). If NULL, uses the column names of the taxonomy table in their existing order. Used to determine parent-child relationships for redundant suffix detection. |
modify_phyloseq |
(logical, default FALSE) If TRUE, replace problematic values with NA in the taxonomy table and return the modified phyloseq object. The following types of values are replaced:
Messages will indicate the number of values replaced for each type. |
remove_border_spaces |
(logical, default TRUE) If TRUE and
|
remove_all_space |
(logical, default FALSE) If TRUE and
|
replace_space_with |
(character, default "_") Character to use when
replacing internal spaces. Only used when |
detect_invisible_chars |
(logical, default TRUE) If TRUE, scan
taxonomic values for invisible / unusual characters: anything in
Unicode category |
replace_invisible_chars |
(logical, default FALSE) If TRUE and
|
invisible_chars_replacement |
(character, default |
If modify_phyloseq = FALSE (default): Nothing (invisible NULL).
Warnings/messages only if verbose = TRUE and issues are found.
If modify_phyloseq = TRUE: The modified phyloseq object with problematic
values replaced by NA, along with messages summarizing the changes.
Adrien Taudière
verify_tax_table(data_fungi_mini) verify_tax_table(data_fungi_mini, verbose = TRUE) # Check for redundant "_sp" patterns (default) data_fungi2 <- data_fungi_mini data_fungi2@tax_table[1, "Species"] <- "Eutypa_sp" verify_tax_table(data_fungi2, verbose = TRUE, redundant_suffix = "_sp") # Automatically replace problematic values with NA # This replaces: NA-like patterns, short values, and redundant suffixes data_fungi2_cleaned <- verify_tax_table(data_fungi2, modify_phyloseq = TRUE ) # Check that the redundant value was replaced data_fungi2@tax_table[1, "Species"] # "Eutypa_sp" data_fungi2_cleaned@tax_table[1, "Species"] # NA # Combine verbose mode with modifications to see all issues data_fungi2_cleaned <- verify_tax_table(data_fungi2, verbose = TRUE, modify_phyloseq = TRUE ) # Check for other patterns like "_var" or "_cf" verify_tax_table(data_fungi_mini, verbose = TRUE, redundant_suffix = "_var") # Disable redundant suffix check verify_tax_table(data_fungi_mini, verbose = TRUE, redundant_suffix = NULL) # Specify custom taxonomic rank order verify_tax_table(data_fungi_mini, verbose = TRUE, taxonomic_ranks = c("Class", "Order", "Family", "Genus") ) # Handle whitespace in taxonomic values # Create example with spaces data_fungi3 <- data_fungi_mini data_fungi3@tax_table[1, "Genus"] <- " Russula " data_fungi3@tax_table[2, "Species"] <- "Russula emetica" # Check for spaces (verbose mode) verify_tax_table(data_fungi3, verbose = TRUE) # Remove leading/trailing whitespace (enabled by default) data_fungi3_trimmed <- verify_tax_table(data_fungi3, modify_phyloseq = TRUE) data_fungi3_trimmed@tax_table[1, "Genus"] # "Russula" (trimmed) # Also replace internal spaces with underscores data_fungi3_cleaned <- verify_tax_table(data_fungi3, modify_phyloseq = TRUE, remove_all_space = TRUE, replace_space_with = "_" ) data_fungi3_cleaned@tax_table[2, "Species"] # "Russula_emetica"verify_tax_table(data_fungi_mini) verify_tax_table(data_fungi_mini, verbose = TRUE) # Check for redundant "_sp" patterns (default) data_fungi2 <- data_fungi_mini data_fungi2@tax_table[1, "Species"] <- "Eutypa_sp" verify_tax_table(data_fungi2, verbose = TRUE, redundant_suffix = "_sp") # Automatically replace problematic values with NA # This replaces: NA-like patterns, short values, and redundant suffixes data_fungi2_cleaned <- verify_tax_table(data_fungi2, modify_phyloseq = TRUE ) # Check that the redundant value was replaced data_fungi2@tax_table[1, "Species"] # "Eutypa_sp" data_fungi2_cleaned@tax_table[1, "Species"] # NA # Combine verbose mode with modifications to see all issues data_fungi2_cleaned <- verify_tax_table(data_fungi2, verbose = TRUE, modify_phyloseq = TRUE ) # Check for other patterns like "_var" or "_cf" verify_tax_table(data_fungi_mini, verbose = TRUE, redundant_suffix = "_var") # Disable redundant suffix check verify_tax_table(data_fungi_mini, verbose = TRUE, redundant_suffix = NULL) # Specify custom taxonomic rank order verify_tax_table(data_fungi_mini, verbose = TRUE, taxonomic_ranks = c("Class", "Order", "Family", "Genus") ) # Handle whitespace in taxonomic values # Create example with spaces data_fungi3 <- data_fungi_mini data_fungi3@tax_table[1, "Genus"] <- " Russula " data_fungi3@tax_table[2, "Species"] <- "Russula emetica" # Check for spaces (verbose mode) verify_tax_table(data_fungi3, verbose = TRUE) # Remove leading/trailing whitespace (enabled by default) data_fungi3_trimmed <- verify_tax_table(data_fungi3, modify_phyloseq = TRUE) data_fungi3_trimmed@tax_table[1, "Genus"] # "Russula" (trimmed) # Also replace internal spaces with underscores data_fungi3_cleaned <- verify_tax_table(data_fungi3, modify_phyloseq = TRUE, remove_all_space = TRUE, replace_space_with = "_" ) data_fungi3_cleaned@tax_table[2, "Species"] # "Russula_emetica"
Use of VSEARCH software.
vs_search_global( physeq, path_to_fasta = NULL, seq2search = NULL, vsearchpath = find_vsearch(), id = 0.8, iddef = 0, keep_temporary_files = FALSE )vs_search_global( physeq, path_to_fasta = NULL, seq2search = NULL, vsearchpath = find_vsearch(), id = 0.8, iddef = 0, keep_temporary_files = FALSE )
physeq |
(required) a |
path_to_fasta |
(required if seq2search is NULL) a path to fasta file if seq2search is est to NULL. |
seq2search |
(required if path_to_fasta is NULL) Either (i) a DNAStringSet object
or (ii) a character vector that will be convert to DNAStringSet using
|
vsearchpath |
(default: |
id |
(default: 0.8) id for the option |
iddef |
(default: 0) iddef for the option |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files
|
This function is mainly a wrapper of the work of others. Please cite vsearch.
A dataframe with uc results (invisible)
Adrien Taudière
if (requireNamespace("seqinr")) { file_dna <- tempfile("dna.fa") seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCAACC", file = file_dna, names = "seq1" ) res <- vs_search_global(data_fungi, path_to_fasta = file_dna) unlink(file_dna) res[res$identity != "*", ] clean_pq(subset_taxa(data_fungi, res$identity != "*")) }if (requireNamespace("seqinr")) { file_dna <- tempfile("dna.fa") seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCAACC", file = file_dna, names = "seq1" ) res <- vs_search_global(data_fungi, path_to_fasta = file_dna) unlink(file_dna) res[res$identity != "*", ] clean_pq(subset_taxa(data_fungi, res$identity != "*")) }
physeq
or cluster a list of DNA sequences using vsearch softwareA wrapper of VSEARCH software.
vsearch_clustering( physeq = NULL, dna_seq = NULL, nproc = 1, id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE )vsearch_clustering( physeq = NULL, dna_seq = NULL, nproc = 1, id = 0.97, vsearchpath = find_vsearch(), tax_adjust = 0, rank_propagation = FALSE, vsearch_cluster_method = "--cluster_size", vsearch_args = "--strand both", keep_temporary_files = FALSE )
physeq |
(required) a |
dna_seq |
You may directly use a character vector of DNA sequences
in place of physeq args. When physeq is set, dna sequences take the value of
|
nproc |
(default: 1) Set to number of cpus/processors to use for the clustering |
id |
(default: 0.97) level of identity to cluster |
vsearchpath |
(default: "vsearch") path to vsearch |
tax_adjust |
(Default 0) See the man page
of |
rank_propagation |
(logical, default FALSE). Do we propagate the
NA value from lower taxonomic rank to upper rank?
See the man page of |
vsearch_cluster_method |
(default: "–cluster_size) See other possible
methods in the vsearch manual (e.g.
|
vsearch_args |
(default : "–strand both") a one length character element defining other parameters to passed on to vsearch. |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files ?
|
This function use the merge_taxa_vec() function to
merge taxa into clusters. By default tax_adjust = 0. See the man page
of merge_taxa_vec().
This function is mainly a wrapper of the work of others. Please cite vsearch.
A new object of class physeq or a list of cluster if dna_seq
args was used.
Adrien Taudière
VSEARCH can be downloaded from https://github.com/torognes/vsearch. More information in the associated publication https://pubmed.ncbi.nlm.nih.gov/27781170.
postcluster_pq(), swarm_clustering()
summary_plot_pq(data_fungi) d_vs <- vsearch_clustering(data_fungi) summary_plot_pq(d_vs)summary_plot_pq(data_fungi) d_vs <- vsearch_clustering(data_fungi) summary_plot_pq(d_vs)
Wrapper around DESeq2::varianceStabilizingTransformation()
(Love, Huber & Anders 2014, doi:10.1186/s13059-014-0550-8). Counts
are incremented by 1 to handle zeros before VST is applied.
vst_pq(physeq, blind = TRUE, fitType = "parametric")vst_pq(physeq, blind = TRUE, fitType = "parametric")
physeq |
(required) a |
blind |
(logical, default |
fitType |
(character, default |
A new phyloseq-class object with a VST
transformed otu_table.
Adrien Taudière
DESeq2::varianceStabilizingTransformation()
data_f_vst <- vst_pq(data_fungi_mini)data_f_vst <- vst_pq(data_fungi_mini)
This is the reverse function of read_pq().
write_pq( physeq, path = NULL, rdata = FALSE, one_file = FALSE, write_sam_data = TRUE, sam_data_first = FALSE, clean_pq = TRUE, reorder_taxa = FALSE, rename_taxa = FALSE, remove_empty_samples = TRUE, remove_empty_taxa = TRUE, clean_samples_names = TRUE, silent = FALSE, verbose = FALSE, quote = FALSE, sep_csv = "\t", ... )write_pq( physeq, path = NULL, rdata = FALSE, one_file = FALSE, write_sam_data = TRUE, sam_data_first = FALSE, clean_pq = TRUE, reorder_taxa = FALSE, rename_taxa = FALSE, remove_empty_samples = TRUE, remove_empty_taxa = TRUE, clean_samples_names = TRUE, silent = FALSE, verbose = FALSE, quote = FALSE, sep_csv = "\t", ... )
physeq |
(required) a |
path |
a path to the folder to save the phyloseq object |
rdata |
(logical) does the phyloseq object is also saved in Rdata format? |
one_file |
(logical) if TRUE, combine all data in one file only |
write_sam_data |
(logical) does the samples data are add to
the file. Only used if |
sam_data_first |
(logical) if TRUE, put the sample data at the top of the table
Only used if |
clean_pq |
(logical) If set to TRUE, empty samples are discarded after subsetting taxa (ASV, OTU, ...) |
reorder_taxa |
(logical) if TRUE the otu_table is ordered by the number of sequences of taxa (ASV, OTU, ...) (descending order). Default to TRUE. Only possible if clean_pq is set to TRUE. |
rename_taxa |
reorder_taxa (logical) if TRUE, taxa (ASV, OTU, ...) are renamed by their position in the OTU_table (asv_1, asv_2, ...). Default to FALSE. Only possible if clean_pq is set to TRUE. |
remove_empty_samples |
(logical) Do you want to remove samples without sequences (this is done after removing empty taxa) |
remove_empty_taxa |
(logical) Do you want to remove taxa without sequences (this is done before removing empty samples) |
clean_samples_names |
(logical) Do you want to clean samples names? |
silent |
(logical) If true, no message are printing. |
verbose |
(logical) Additional informations in the message the verbose parameter overwrite the silent parameter. |
quote |
a logical value (default FALSE) or a numeric vector. If TRUE, any character or factor columns will be surrounded by double quotes. If a numeric vector, its elements are taken as the indices of columns to quote. In both cases, row and column names are quoted if they are written. If FALSE nothing is quoted. |
sep_csv |
(default tabulation) separator for column |
... |
Additional arguments passed on to |
Build a folder (path) containing one to four csv tables (refseq.csv, otu_table.csv, tax_table.csv, sam_data.csv) and if present a phy_tree in Newick format
Adrien Taudière
write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"), one_file = TRUE) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq")) write_pq(data_fungi, path = paste0(tempdir(), "/phyloseq"), one_file = TRUE) unlink(paste0(tempdir(), "/phyloseq"), recursive = TRUE)